TMB0409, TMB0409 (genetic_marker) Gossypium hirsutum

Marker Overview
NameTMB0409
AliasTMP02
Genbank IDBV679885
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
Source Sequencereverse_complement_BV679885.1
Source Typegenomic
Repeat Motif(CA)10+(GA)5
PCR ConditionAnnealing temperature: 55
Primer 1TMB0409_F: CAGAGGACGAAGGTAGCAG
Primer 2TMB0409_R: TGGTGGGTTTCACTTTCACA
Product Length221
ContactYu, John Z. (Zhi-Hong)
CommentPrimer data obtained in 2005-10
Germplasm
Stock NameType
TM-1breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBV679885
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TMB0409_FTMB0409_FGossypium hirsutumprimer
TMB0409_RTMB0409_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.DJiM-RIL_ch01.hj08-13.1Gossypium hirsutumQTL
fiber elongationqFEL.DJiM-RIL_ch15.hj08-13.1Gossypium hirsutumQTL
fiber strengthqFS.DJiM-RIL_ch01.h11Gossypium hirsutumQTL
fiber strengthqFS.DJiM-RIL_ch15.h11Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TMB0409TMB0409Gossypium hirsutummarker_locus
TMP02TMP02Gossypium hirsutummarker_locus
TMP02aTMP02aGossypium hirsutummarker_locus
TMP02bTMP02bGossypium hirsutummarker_locus
TMB0409TMB0409-113.636Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
reverse_complement_BV679885.1reverse_complement_BV679885.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Yu, John Z. (Zhi-Hong)
Description:Cotton molecular genetics and genomics including integrative genome mapping and QTL identification from the Gossypium germplasm.
First name:John
Last name:Yu
Title:Research Geneticist
Institution:USDA-ARS
Address:2765 F&B Road, College Station, Texas 77845
Country:United States
Email:zyu@qutun.tamu.edu
Phone:1-979-260-9237
Fax:1-979-260-9333
Keywords:Cotton Molecular Genetics
Last update:6-Sep-2007
Sequence
>TMB0409 ID=TMB0409|Name=TMB0409|organism=Gossypium hirsutum|type=genetic_marker|length=221bp
CAGAGGACGAAGGTAGCAGATTAAAAGAGGATAAGGGGGTGCCGCTAGCT
TGAGTTATAAAAGAGGGTACTCTTACAAAGCCCACCATTATTACTCCCAA
TCTCTCTCTCTTTCACACACACACACACACACACTTCTTCCCTATTTCCA
TCTCTGCACTTTTGAGGAGCTAAGAAGATTCGATTCTAATTTCTAAAACG
CTGTGAAAGTGAAACCCACCA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c01N/AAD_chr.0130.74TMB0409
2(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr11-3N/AAD_chr.1127TMB0409
3DH962 x Jinmian-6, F2 (2009)DJ-F2_chrU/LG6N/AAD_chr.unknown44TMB0409
4DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.0166.44TMB0409
5DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.1566.44TMB0409
6TM-1 x 3-79, RIL (2014)T3-RIL.14_chr01N/AAD_chr.01113.6TMB0409
7DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.0157.9TMB0409
8DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.1557.9TMB0409
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr01N/AAt.01108.7TMB0409
10TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr01-1N/AAD_chr.0184TMP02
110-153 x sGK9708, RIL (2016)0s-RIL_chr01-2N/AAD_chr.0130.1TMP02a
120-153 x sGK9708, RIL (2017)0s-RIL.17_chr01N/AAD_chr.0180.78TMP02a
130-153 x sGK9708, RIL (2016)0s-RIL_chr01-2N/AAD_chr.0133.4TMP02b
14TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.01N/AAD_chr.01113.64TMB0409