SHIN-0316, SHIN-0316 (genetic_marker) Gossypium hirsutum

Marker Overview
NameSHIN-0316
Genbank IDAI726568
TypeSSR
SpeciesGossypium hirsutum
GermplasmAcala Maxxa
Source SequenceAI726568.1
Source TypeEST
Primer 1SHIN-0316_F: TTGAATCTAGGGATTTGCGG
Primer 2SHIN-0316_R: TGGCGACTGAACAACAAAGA
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Acala Maxxacultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SHIN-0316_FSHIN-0316_FGossypium hirsutumprimer
SHIN-0316_RSHIN-0316_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AI726568.1AI726568.1Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SHIN-0316SHIN-0316Gossypium hirsutummarker_locus


Contact
NameDetails
Monsanto
Country:United States
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D02chromosomeD02:201503..201714 -
A02chromosomeA02:155469..155674 -
CM018216.1chromosomeCM018216.1:180097..180308 -
CM018203.1chromosomeCM018203.1:144296..144501 -
D5_03chromosomeD5_03:62853683..62853900 +
KI_03chromosomeKI_03:157949..158154 -
Chr5chromosomeChr5:26238810..26239013 +
Chr03_CRI-A2_v1.0.a1chromosomeChr03_CRI-A2_v1.0.a1:153405..153608 -
Chr5chromosomeChr5:146742..146959 -
D10_03chromosomeD10_03:61251411..61251623 -
At_chr1chromosomeAt_chr1:106787053..106787264 +
scaffold1428.1supercontigscaffold1428.1:159813..160018 -
D02chromosomeD02:192000..192211 -
A02chromosomeA02:146046..146251 -
Ghir_A02chromosomeGhir_A02:173934..174139 +
Ghir_D02chromosomeGhir_D02:194218..194429 -
Ghir_A02chromosomeGhir_A02:179382..179587 -
D02chromosomeD02:191942..192153 -
A02chromosomeA02:196344..196549 -
D02chromosomeD02:193097..193308 -
A02chromosomeA02:167511..167716 -
D02chromosomeD02:192880..193091 -
A02chromosomeA02:170878..171083 -
scaffold46912supercontigscaffold46912:1484..1695 +
scaffold26500supercontigscaffold26500:36153..36364 +
scaffold26500supercontigscaffold26500:44019..44224 +
Gbar_D02chromosomeGbar_D02:187792..188001 -
Gbar_A02chromosomeGbar_A02:76728..76933 -
D02chromosomeD02:184755..184966 -
A02chromosomeA02:128097..128302 -
CM017624.1chromosomeCM017624.1:185169..185380 -
CM017611.1chromosomeCM017611.1:171384..171589 -
CM017650.1chromosomeCM017650.1:198300..198513 -
CM017637.1chromosomeCM017637.1:158664..158869 -
CM017689.1chromosomeCM017689.1:146360..146565 -
Sequence
>SHIN-0316 ID=SHIN-0316|Name=SHIN-0316|organism=Gossypium hirsutum|type=genetic_marker|length=212bp
TTGAATCTAGGGATTTGCGGGTGGAGAAGACGAGAGCTCATCTCTCTGCT
TCAAAGTTTGTTCCTTTATTCCTTTCAAACCCTTTCCTTTTTTTAACTTG
ATTTCATTTTCTCAGATTTGTTCTTTTTCTCTCTCTCTCTCTCTCTCCAG
GCTCCTGTCCAGGTAGAATTCTCTTCTTCCTTTGCGTTGTGTTCTTTGTT
GTTCAGTCGCCA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.0247.1SHIN-0316View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAI726568