NBRI_e1952, NBRI_e1952 (genetic_marker) Gossypium herbaceum

Marker Overview
NameNBRI_e1952
Genbank IDHQ527867
TypeSSR
SpeciesGossypium herbaceum
GermplasmVagad
Source TypeEST
Repeat Motif(TCT)5….(TTC)7
PCR ConditionAnnealing temperature: 58
Primer 1NBRI_e1952_F: GGCTCACCTCTTCAGAGAAAG
Primer 2NBRI_e1952_R: CAGTGATATGGGAGGTGTGG
Product Length154
Publication[view all]
ContactLin, Zhong-Xu
CommentCompound Imperfect; Primer data obtained in 2012
Germplasm
Stock NameType
VagadTBD
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankHQ527867
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NBRI_e1952_FNBRI_e1952_FGossypium herbaceumprimer
NBRI_e1952_RNBRI_e1952_RGossypium herbaceumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NBRI_HQ527867NBRI_HQ527867Gossypium herbaceummarker_locus


Contact
NameDetails
Lin, Zhong-Xu
First name:Zhong-Xu
Last name:Lin
Address:shizishan 1, wuhan, hubei 430070
Country:China
Email:linzhongxu@mail.hzau.edu.cn
Phone:+86 027 87283955
Last update:5-Mar-2007
Sequence
>NBRI_e1952 ID=NBRI_e1952|Name=NBRI_e1952|organism=Gossypium herbaceum|type=genetic_marker|length=154bp
GGCTCACCTCTTCAGAGAAAGAATCTTCTTCTTCTTCTTTCTTTCTTCTT
CTTCTTCTTCTTCACTTTACATCCATCAAGGCTGAAGAAAAAAATTAGGT
TATTCTGAGTGATGGGTGTGAGCTGCCGTTGTTCCCACACCTCCCATATC
ACTG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr07-1N/AAD_chr.0782.12NBRI_HQ527867View
2DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.0154.1NBRI_HQ527867View
3DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.1554.1NBRI_HQ527867View