NAU5433, NAU5433 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU5433
Genbank IDDR453064
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDR453064.1
Source TypeEST
Repeat Motif(ggagca)3
PCR ConditionAnnealing temperature: 57
Primer 1NAU5433_F: CTTAGGATGGCCGAATAAAA
Primer 2NAU5433_R: CAAGTGCTCCACCACAAAT
Restriction EnzymeEcoRI; XhoI
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
Xuzhou 142breeding_germplasm
Xuzhou 142breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDR453064
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU5433_FNAU5433_FGossypium hirsutumprimer
NAU5433_RNAU5433_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
boll numberqBN.DJiM-RIL_ch06.h13.1Gossypium hirsutumQTL
lint percentqLP.DJiM-RIL_ch06.h12.1Gossypium hirsutumQTL
lint percentqLP.DJiM-RIL_ch06.h12.2Gossypium hirsutumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
short fiber contentqSFC.PA-F2_ch06.pop32-06Gossypium hirsutum x mustelinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU5433NAU5433Gossypium hirsutummarker_locus
NAU5433-260NAU5433-260Gossypium hirsutummarker_locus
NAU5433NAU5433-44Gossypium hirsutummarker_locus
NAU5433NAU5433-167.3Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DR453064.1DR453064.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU5433 ID=NAU5433|Name=NAU5433|organism=Gossypium hirsutum|type=genetic_marker|length=223bp
CTTAGGATGGCCGAATAAAACAAAAATCTCTAGCAAGTCATTCAAGTCTA
TGAAAACTACAAACTAACCTGTGTCAAAATCACAGATACCATCACAATAA
CAAATTTTTTAAATAGGAAAAACATTTGCAAAAATAAGAAAACCTCACTC
CCAGNCCAGTGGGAGCAGGAGCAGGAGCAGATACATCGATTCCAGGGGCC
AGGGATTTGTGGTGGAGCACTTG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A06-1N/AAD_chr.0644NAU5433View
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr06N/AAD_chr.0698.81NAU5433View
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr06N/AAD_chr.06181NAU5433View
4Yumian-1 x T586, RIL (2015)YT-RIL.15_chr06N/AAD_chr.0663.2NAU5433View
5DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr06N/AAD_chr.0634.66NAU5433View
60-153 x sGK9708, RIL (2016)0s-RIL_chr06-1N/AAD_chr.0642NAU5433View
7DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr06N/AAD_chr.0630.8NAU5433View
8SG 747 x Giza 75, BIL (2013)SG-BIL_chr06N/AAD_chr.0666NAU5433View
9CCRI-36 x G2005, RIL (2016)CG-RIL_chr06N/AAD_chr.0657.9NAU5433View
10TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr06N/AAD_chr.0699.4NAU5433-260View
11TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr06/A6N/AAD_chr.0657.4NAU5433-260View
12(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A06-1N/AAD_chr.0644NAU5433View
13PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr06N/AAt.06167.3NAU5433View