NAU5120, NAU5120 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU5120
AliasNAU5120=NAU2820
NAU2820
Genbank IDDT561214
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
TM-1
Source SequenceDT561214.1
Source TypeEST
Repeat Motif(tcacca)5
PCR ConditionAnnealing temperature: 57
Primer 1NAU5120_F: GCCACCAATAAAGCAACTCT
Primer 2NAU5120_R: TGCATCCTGAAGAAGAGACA
Restriction EnzymeEcoRI; NotI
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
TM-1breeding_germplasm
TM-1breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT561214
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU5120_FNAU5120_FGossypium hirsutumprimer
NAU5120_RNAU5120_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber uniformityqFU.9s-F2.ch16.ay12Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU5120aNAU5120aGossypium hirsutummarker_locus
nau5120nau5120Gossypium hirsutummarker_locus
NAU5120-175NAU5120-175Gossypium hirsutummarker_locus
NAU5120aNAU5120a-46.7Gossypium hirsutummarker_locus
NAU5120bNAU5120bGossypium hirsutummarker_locus
NAU5120cNAU5120cGossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT561214.1DT561214.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D07chromosomeD07:6767431..6767595 +
A07chromosomeA07:6958866..6959038 +
CM018221.1chromosomeCM018221.1:6376453..6376623 +
CM018208.1chromosomeCM018208.1:7216041..7216219 +
D5_07chromosomeD5_07:6369412..6369576 +
Chr1chromosomeChr1:64789168..64789340 -
Chr07_CRI-A2_v1.0.a1chromosomeChr07_CRI-A2_v1.0.a1:7310791..7310963 +
Chr1chromosomeChr1:31507239..31507403 -
D10_07chromosomeD10_07:47489000..47489152 -
CM016620.1chromosomeCM016620.1:106505586..106505762 -
Dt_chr1chromosomeDt_chr1:40146714..40146886 -
D07chromosomeD07:6295751..6295915 +
A07chromosomeA07:6310179..6310351 +
Ghir_D07chromosomeGhir_D07:6640658..6640822 +
Ghir_A07chromosomeGhir_A07:7280441..7280613 +
D07chromosomeD07:6348873..6349037 +
A07chromosomeA07:6835794..6835966 +
D07chromosomeD07:6591092..6591256 +
A07chromosomeA07:7241275..7241447 +
D07chromosomeD07:6444783..6444953 +
A07chromosomeA07:7318871..7319043 +
Dt07chromosomeDt07:6904861..6905031 +
At07chromosomeAt07:6726734..6726900 +
At07chromosomeAt07:6729516..6729694 +
scaffold12091supercontigscaffold12091:102845..103011 +
scaffold12091supercontigscaffold12091:105627..105805 +
scaffold11188supercontigscaffold11188:55188..55358 +
Gbar_D07chromosomeGbar_D07:6648338..6648508 +
Gbar_A07chromosomeGbar_A07:7185798..7185976 +
D07chromosomeD07:6531521..6531691 +
A07chromosomeA07:7027549..7027721 +
CM017629.1chromosomeCM017629.1:6831221..6831385 +
CM017616.1chromosomeCM017616.1:7000304..7000471 +
CM017655.1chromosomeCM017655.1:6793582..6793734 +
CM017642.1chromosomeCM017642.1:7192219..7192391 +
CM017707.1chromosomeCM017707.1:6663305..6663475 +
CM017694.1chromosomeCM017694.1:7078867..7079039 +
Sequence
>NAU5120 ID=NAU5120|Name=NAU5120|organism=Gossypium hirsutum|type=genetic_marker|length=165bp
GCCACCAATAAAGCAACTCTTAAACTACACTACCTTCCTTCATCTTCACC
ATCACCATCACCATCACCATCACCATCTTCAAGGCCGCCCTCTTTCCTTT
AACAGTCTTAATCTCCCTAACCTCAATCTCCTTCTCACGGGTAATTGTCT
CTTCTTCAGGATGCA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr07N/AAD_chr.0711.86NAU5120a
2Emian-22 x 3-79, BC1 (2015)E3-BC1-2015_chr07N/AAD_chr.0720NAU5120a
3901-001 x sGK156, F2 (2019)Chr16N/AAD_chr.1682.33NAU5120a
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.1615nau5120
5H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.1616.5nau5120
6(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr16-1N/AAD_chr.1622.8nau5120
760182 x Jun Mian 1, F2:3 (2007)6J-F2:3_chr16N/AAD_chr.1628.8nau5120
8Yumian-1 x 7235, RIL (2015)Y7-RIL_chr16N/AAD_chr.1651nau5120
9DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr07-2N/AAD_chr.07104.41nau5120
10DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr16N/AAD_chr.16104.41nau5120
11TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr07N/AAD_chr.07107.2nau5120
12W10 x TM-1, F2:3 (2015)WT-F2:3_chr16-1N/AAD_chr.1624.9nau5120
13GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr16N/AAD_chr.1690.7nau5120
14DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr16N/AAD_chr.162.5nau5120
15SG 747 x Giza 75, BIL (2013)SG-BIL_chr16N/AAD_chr.1639.6nau5120
16TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.1647.6NAU5120-175
17TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1647.7NAU5120-175
18H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1647.7NAU5120-175
19PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr16-1N/ADt.0746.7NAU5120a
20901-001 x sGK156, F2 (2019)Chr16N/AAD_chr.1684.99NAU5120b
21901-001 x sGK156, F2 (2019)Chr16N/AAD_chr.1685.68NAU5120c