NAU4956, NAU4956 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU4956
Genbank IDDT551006
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
TM-1
Source SequenceDT551006.1
Source TypeEST
Repeat Motif(ctcttc)7
PCR ConditionAnnealing temperature: 57
Primer 1NAU4956_F: CACTCTCTTTGCCTTTTGGT
Primer 2NAU4956_R: CTTCACGTCTTCCCCTTTTA
Restriction EnzymeEcoRI; NotI
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
TM-1breeding_germplasm
TM-1breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT551006
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU4956_FNAU4956_FGossypium hirsutumprimer
NAU4956_RNAU4956_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber uniformityqFU.0s-RIL_ch16.ay08Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU4956aNAU4956aGossypium hirsutummarker_locus
NAU4956bNAU4956bGossypium hirsutummarker_locus
nau4956nau4956Gossypium hirsutummarker_locus
NAU4956-240NAU4956-240Gossypium hirsutummarker_locus
NAU4956aNAU4956a-28Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT551006.1DT551006.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D07chromosomeD07:7999494..7999756 -
A07chromosomeA07:8729141..8729403 -
CM018221.1chromosomeCM018221.1:7588074..7588318 -
CM018208.1chromosomeCM018208.1:8905792..8906050 -
D5_07chromosomeD5_07:7477749..7477993 -
Chr8chromosomeChr8:96606996..96607240 +
Chr07_CRI-A2_v1.0.a1chromosomeChr07_CRI-A2_v1.0.a1:8975489..8975733 -
Chr1chromosomeChr1:30372766..30373010 +
D10_07chromosomeD10_07:46317768..46318018 +
CM016620.1chromosomeCM016620.1:104324008..104324251 +
scaffold120.1supercontigscaffold120.1:216290..216552 +
Dt_chr1chromosomeDt_chr1:39804910..39805172 +
D07chromosomeD07:7532801..7533063 -
A07chromosomeA07:8071564..8071826 -
Ghir_D07chromosomeGhir_D07:7846622..7846884 -
Ghir_A07chromosomeGhir_A07:9035763..9036025 -
D07chromosomeD07:7521075..7521337 -
A07chromosomeA07:8552659..8552921 -
D07chromosomeD07:7797710..7797972 -
A07chromosomeA07:9001535..9001797 -
D07chromosomeD07:7652233..7652495 -
A07chromosomeA07:9056778..9057040 -
Dt07chromosomeDt07:8487272..8487516 -
scaffold2560supercontigscaffold2560:394345..394603 -
scaffold2445supercontigscaffold2445:271053..271297 -
Gbar_D07chromosomeGbar_D07:7879808..7880052 -
Gbar_A07chromosomeGbar_A07:8863724..8863982 -
D07chromosomeD07:7726933..7727177 -
A07chromosomeA07:8682916..8683174 -
CM017629.1chromosomeCM017629.1:7990769..7991019 -
CM017616.1chromosomeCM017616.1:8679027..8679284 -
CM017655.1chromosomeCM017655.1:8006736..8006986 -
CM017642.1chromosomeCM017642.1:8912427..8912684 -
CM017707.1chromosomeCM017707.1:7845824..7846068 -
CM017694.1chromosomeCM017694.1:8807482..8807747 -
Sequence
>NAU4956 ID=NAU4956|Name=NAU4956|organism=Gossypium hirsutum|type=genetic_marker|length=140bp
CACTCTCTTTGCCTTTTGGTTCTCTTCCTCTTCCTCTTCCTCTTCCTCTT
CCTCTTCCTCTTCTTCACCCAAAAACCCCCGCCCGAAGCTAGGTGAAAGA
AGTTCTCTAATGGATACTCGTAAAAGGGGAAGACGTGAAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr07N/AAD_chr.0733.17NAU4956a
20-153 x sGK9708, RIL (2016)0s-RIL_chr16N/AAD_chr.1668.1NAU4956a
3Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr16N/AAD_chr.1690.56NAU4956b
40-153 x sGK9708, RIL (2016)0s-RIL_chr16N/AAD_chr.1657.3NAU4956b
5AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.1618nau4956
6H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.1621.9nau4956
7TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr07N/AAD_chr.0773.4nau4956
8(86-1 x G. anomalum) x Su8289, BC2F1 (2015)8S-BC2F1_chr07N/AB_chr.07130.6nau4956
9SG 747 x Giza 75, BIL (2013)SG-BIL_chr16N/AAD_chr.1642.7nau4956
10TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.1650.7NAU4956-240
11TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1651.07NAU4956-240
12H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1651NAU4956-240
13MGG-293-793, MAGIC (2018)MAGIC-19831_chr07N/AAD_chr.0728NAU4956a