NAU4891, NAU4891 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU4891
Genbank IDDT545481
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
TM-1
Source SequenceDT545481.1
Source TypeEST
Repeat Motif(gccgct)5
PCR ConditionAnnealing temperature: 57
Primer 1NAU4891_F: GATGGTCAGGCAGAGCTAGT
Primer 2NAU4891_R: AGACCTCACCCTCAGGTGTA
Restriction EnzymeEcoRI; NotI
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
TM-1breeding_germplasm
TM-1breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT545481
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU4891_FNAU4891_FGossypium hirsutumprimer
NAU4891_RNAU4891_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU4891NAU4891Gossypium hirsutummarker_locus
NAU4891-450NAU4891-450Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT545481.1DT545481.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:14327299..14327589 -
A01chromosomeA01:19346474..19346771 -
CM018215.1chromosomeCM018215.1:14173746..14174036 -
CM018202.1chromosomeCM018202.1:17628318..17628624 -
D5_01chromosomeD5_01:13607642..13607932 -
KI_01chromosomeKI_01:8708293..8708587 -
Chr7chromosomeChr7:88697687..88697981 +
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:19614087..19614381 -
Chr2chromosomeChr2:37295442..37295732 +
D10_01chromosomeD10_01:46594692..46594982 +
CM016614.1chromosomeCM016614.1:26458924..26459209 -
At_chr2chromosomeAt_chr2:17494016..17494310 +
Dt_chr2chromosomeDt_chr2:41973023..41973313 -
D01chromosomeD01:13328927..13329217 -
A01chromosomeA01:17991434..17991731 -
Ghir_D01chromosomeGhir_D01:14649689..14649979 -
Ghir_A01chromosomeGhir_A01:18576854..18577151 -
D01chromosomeD01:14358292..14358582 -
A01chromosomeA01:18020138..18020435 -
D01chromosomeD01:14182040..14182330 -
A01chromosomeA01:18456050..18456347 -
D01chromosomeD01:14542454..14542744 -
A01chromosomeA01:19056820..19057117 -
scaffold6738supercontigscaffold6738:29598..29904 +
scaffold6738supercontigscaffold6738:26462..26764 +
scaffold6738supercontigscaffold6738:18664..18966 +
scaffold3545supercontigscaffold3545:505475..505765 +
Gbar_D01chromosomeGbar_D01:14772123..14772413 -
Gbar_A01chromosomeGbar_A01:17775778..17776084 -
D01chromosomeD01:14575679..14575969 -
A01chromosomeA01:17639739..17640045 -
CM017623.1chromosomeCM017623.1:14417817..14418107 -
CM017610.1chromosomeCM017610.1:19029792..19030092 -
CM017649.1chromosomeCM017649.1:15277999..15278289 -
CM017636.1chromosomeCM017636.1:18180478..18180778 -
CM017701.1chromosomeCM017701.1:14563295..14563585 -
CM017688.1chromosomeCM017688.1:17777619..17777919 -
Chr02chromosomeNAU4891:1..790 .
Chr02:15428837..15429614 -
Chr2chromosomeNAU4891:1..790 .
Chr2:37295209..37295986 +
Sequence
>NAU4891 ID=NAU4891|Name=NAU4891|organism=Gossypium hirsutum|type=genetic_marker|length=298bp
GATGGTCAGGCAGAGCTAGTTTCATCTCCTCTGGCTTCACCTTCAGGGGT
TGATGATGAAGCTCTAGTTACCACAGCAGAAGGTGATAACTCTCCTGATG
CTGTAAATGATGAGAAGAATGAGGAAGGTTATATAGGTGAAGAGACTGTT
GCCGAAGGATCTGAAAAGTCGAATGATGGTAATGAGCAGAGTGTAGTGGA
GACGGATCCAATGCCTGAAGCCGCTGCCGCTGCCGCTGCCGCTGCCGCTG
GCACTAATGAGAGTGGCACAACAAGTGGTACACCTGAGGGTGAGGTCT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0119.59NAU4891
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr01N/AAD_chr.0181NAU4891
3Prema x 86-1, RIL (2015)P8-RIL_chr01.3N/AAD_chr.018.83NAU4891
4DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.0180.56NAU4891
5DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.1580.56NAU4891
6TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr01-1N/AAD_chr.0162.7NAU4891
7DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.0149NAU4891
8DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.1549NAU4891
9TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr01N/AAD_chr.0161.7NAU4891-450
10TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr01/A1N/AAD_chr.0164.71NAU4891-450