NAU4057, NAU4057 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU4057
Genbank IDCO130626
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(c(tc)5cc(tc)3)9.5
PCR ConditionAnnealing temperature: 57
Primer 1NAU4057_F: ACAACCACCAACGCTAATCT
Primer 2NAU4057_R: TCCCTCGTTGTCTTTCTCTC
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO130626
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU4057_FNAU4057_FGossypium raimondiiprimer
NAU4057_RNAU4057_RGossypium raimondiiprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqFL.SG-BIL_ch05.aksu07Gossypium hirsutum x barbadenseQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU4057NAU4057Gossypium raimondiimarker_locus
NAU4057-230NAU4057-230Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A05chromosomeA05:96984934..96985168 +
D04chromosomeD04:3784404..3784607 -
CM018206.1chromosomeCM018206.1:98930668..98930896 +
CM018218.1chromosomeCM018218.1:3209235..3209438 -
D5_04chromosomeD5_04:46940570..46940774 +
KI_06chromosomeKI_06:30433313..30433527 -
Chr12chromosomeChr12:138215703..138215909 +
Chr04_CRI-A2_v1.0.a1chromosomeChr04_CRI-A2_v1.0.a1:94802593..94802799 +
scaffold228supercontigscaffold228:206344..206548 +
CM016617.1chromosomeCM016617.1:4633853..4634072 -
At_chr9chromosomeAt_chr9:57115051..57115255 -
At_chr9chromosomeAt_chr9:55982785..55982988 -
scaffold77834supercontigscaffold77834:223..426 +
A05chromosomeA05:88657196..88657430 +
Ghir_A05chromosomeGhir_A05:105666831..105667064 +
Ghir_D04chromosomeGhir_D04:3392510..3392713 -
A05chromosomeA05:107242711..107242947 +
D04chromosomeD04:3412880..3413083 -
A05chromosomeA05:105770419..105770651 +
D04chromosomeD04:3257939..3258142 -
A05chromosomeA05:103723649..103723884 +
D04chromosomeD04:3092325..3092528 -
scaffold12118supercontigscaffold12118:2290..2493 +
Gbar_A05chromosomeGbar_A05:99026284..99026509 +
Gbar_D04chromosomeGbar_D04:3182875..3183078 -
A05chromosomeA05:103916521..103916747 +
D04chromosomeD04:3221868..3222071 -
CM017614.1chromosomeCM017614.1:101340771..101341013 +
CM017626.1chromosomeCM017626.1:3318925..3319128 -
CM017640.1chromosomeCM017640.1:109859555..109859783 +
CM017652.1chromosomeCM017652.1:3345886..3346088 -
CM017692.1chromosomeCM017692.1:101867631..101867849 +
CM017704.1chromosomeCM017704.1:3416451..3416654 -
Sequence
>NAU4057 ID=NAU4057|Name=NAU4057|organism=Gossypium raimondii|type=genetic_marker|length=205bp
ACAACCACCAACGCTAATCTCCTTAGATCCATCATCTCTAACAATTACAA
ACAATCACCCCCCTCTCTCTCTCCCTCTCTCTTTGGCTCTACGAATTTCA
AACTTAATTTCGTTATTGGTTTTTTTTGTTTTGCCTAGGGTTTTTGTTAA
AATTTAAAAATCCAAAGAAGATTCAAAGAAGGTAGGAGAGAAAGACAACG
AGGGA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A05-2N/AAD_chr.050NAU4057
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr05N/AAD_chr.05148.72NAU4057
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.05314NAU4057
4Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch05/A05-2N/AAD_chr.0555.6NAU4057
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr05-2N/AAD_chr.0529.1NAU4057
6Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.05111.6NAU4057
7DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr05-2N/AAD_chr.0537.8NAU4057
8TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr05-1N/AAD_chr.0595.6NAU4057
9Emian-22 x 3-79, BC1 (2015)E3-BC1-2015_chr05N/AAD_chr.05222NAU4057
100-153 x sGK9708, RIL (2016)0s-RIL_chr05-2N/AAD_chr.05158.3NAU4057
11DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr05-1N/AAD_chr.05-121.7NAU4057
12CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr05N/AAt.05225.4NAU4057
13SG 747 x Giza 75, BIL (2013)SG-BIL_chr05N/AAD_chr.05173.9NAU4057
14LMY28 x XLZ24, RIL (2018)LX-RIL_chr05N/AAD_chr.05163.46NAU4057
15TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr05N/AAD_chr.05191NAU4057-230
16TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr05/A5N/AAD_chr.05178.52NAU4057-230