NAU4045, NAU4045 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU4045
Genbank IDCO130189
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(gtc)8
PCR ConditionAnnealing temperature: 57
Primer 1NAU4045_F: CCTCTTCTTCACCCTCTTCA
Primer 2NAU4045_R: ATGTGCAGGTTCTTCACTCA
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO130189
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU4045_FNAU4045_FGossypium raimondiiprimer
NAU4045_RNAU4045_RGossypium raimondiiprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber strengthqFS.GG-F2_ch08.sy07Gossypium hirsutumQTL
fiber strengthqFS.GVG-RIL_ch14-1.cz12-bcGossypium hirsutumQTL
seed oil contentqSOC.GVG-RIL_ch14-1.xy12-rilGossypium hirsutumQTL
seed cotton weight per bollqBWT.9s-F2.ch01.ay12.1Gossypium hirsutumQTL
seed cotton weight per bollqBWT.9s-F2.ch01.ay12.2Gossypium hirsutumQTL
fiber lengthqFL.9s-F2.ch01.ay14Gossypium hirsutumQTL
fiber uniformityqFU.9s-F2.ch01.ay12Gossypium hirsutumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqUHML.PA-F2_ch15.pop15-06Gossypium hirsutum x mustelinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU4045aNAU4045aGossypium raimondiimarker_locus
NAU4045bNAU4045bGossypium raimondiimarker_locus
nau4045nau4045Gossypium raimondiimarker_locus
NAU4045-160NAU4045-160Gossypium raimondiimarker_locus
NAU4045-350NAU4045-350Gossypium raimondiimarker_locus
NAU4045NAU4045-36.9Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A01chromosomeA01:3184693..3184869 -
A01chromosomeA01:3485924..3486094 -
CM018215.1chromosomeCM018215.1:2303351..2303521 -
CM018202.1chromosomeCM018202.1:2507622..2507789 -
D5_01chromosomeD5_01:2334955..2335119 -
Chr7chromosomeChr7:107772394..107772561 -
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:2475947..2476114 -
Chr8chromosomeChr8:61997353..61997517 +
D10_01chromosomeD10_01:58264052..58264216 +
CM016614.1chromosomeCM016614.1:3431917..3432081 -
scaffold1463.1supercontigscaffold1463.1:72600..72776 +
scaffold3710_D01supercontigscaffold3710_D01:110157..110333 -
A01chromosomeA01:2245931..2246101 -
Ghir_D01chromosomeGhir_D01:2493764..2493940 -
Ghir_A01chromosomeGhir_A01:2781108..2781278 -
D01chromosomeD01:2371649..2371825 -
A01chromosomeA01:2674935..2675105 -
D01chromosomeD01:2488491..2488667 -
A01chromosomeA01:2800794..2800964 -
D01chromosomeD01:2291189..2291353 -
A01chromosomeA01:2752757..2752927 -
scaffold12265supercontigscaffold12265:278042..278209 +
scaffold7906supercontigscaffold7906:604377..604547 -
Gbar_D01chromosomeGbar_D01:2534820..2534990 -
Gbar_A01chromosomeGbar_A01:2497125..2497292 -
D01chromosomeD01:2432319..2432489 -
A01chromosomeA01:2497688..2497855 -
CM017623.1chromosomeCM017623.1:2546059..2546223 -
CM017610.1chromosomeCM017610.1:3016633..3016803 -
CM017649.1chromosomeCM017649.1:2357273..2357437 -
CM017636.1chromosomeCM017636.1:2542803..2542976 -
CM017701.1chromosomeCM017701.1:2681898..2682068 -
CM017688.1chromosomeCM017688.1:2524384..2524551 -
Chr8chromosomeNAU4045:1..807 .
Chr8:61996371..61997804 -
Chr02chromosomeNAU4045:1..807 .
Chr02:2312109..2313542 +
Sequence
>NAU4045 ID=NAU4045|Name=NAU4045|organism=Gossypium raimondii|type=genetic_marker|length=165bp
CCTCTTCTTCACCCTCTTCATCTTCATCACTGTCGTCATCGTCGTCGTCG
TCGTCATCGTCATCGCCGTCGCCTTCATCGTCGTCATCATCGTCTTTAAC
ATCCTCGCCCTCCTCGTCATCAGCTATCAGGACAGGAGGACCGGATGAGT
GAAGAACCTGCACAT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0179.25NAU4045a
2SG 747 x Giza 75, BIL (2013)SG-BIL_chr01-1N/AAD_chr.010NAU4045a
3Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr15N/AAD_chr.1536.87NAU4045b
4SG 747 x Giza 75, BIL (2013)SG-BIL_chr08N/AAD_chr.0857.5NAU4045b
5AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr01N/AAD_chr.01185nau4045
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr08N/AAD_chr.08115nau4045
7Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0115.3nau4045
8Prema x 86-1, RIL (2015)P8-RIL_chr01.1N/AAD_chr.014.72nau4045
9IL138-A11-3 x TM-1, F2:3 (2014)ILTM-F2:3_chr01N/AAD_chr.010nau4045
10GX1135 x GX100-2, F2 (2013)GG-F2_chr08N/AAD_chr.0834.5nau4045
11GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.0132.4nau4045
12(86-1 x G. anomalum) x Su8289, BC2F1 (2015)8S-BC2F1_chr01N/AB_chr.01111.5nau4045
13GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr14-1N/AAD_chr.1492.6nau4045
14CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr15N/ADt.01136.3nau4045
15901-001 x sGK156, F2 (2019)Chr01N/AAD_chr.0113.36nau4045
16TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr01N/AAD_chr.0124.8NAU4045-160
17TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr01/A1N/AAD_chr.0128.19NAU4045-160
18TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr08N/AAD_chr.0857.8NAU4045-350
19TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr08/A8N/AAD_chr.0869.29NAU4045-350
20PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr15N/ADt.0136.9NAU4045