NAU4031, NAU4031 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU4031
Genbank IDCO129562
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(ctg)8
PCR ConditionAnnealing temperature: 57
Primer 1NAU4031_F: TAATGCTAGGTTGCTGGACA
Primer 2NAU4031_R: TTTGATCAACAGCAACAACC
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO129562
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU4031_FNAU4031_FGossypium raimondiiprimer
NAU4031_RNAU4031_RGossypium raimondiiprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
lint percentqLP.9s-F2.ch05.hi13Gossypium hirsutumQTL
micronaireqMIC.9s-F2.ch05.hi13Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU4031NAU4031Gossypium raimondiimarker_locus
NAU4031NAU4031-175.1Gossypium raimondiimarker_locus
NAU4031bNAU4031bGossypium raimondiimarker_locus
NAU4031aNAU4031aGossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D05chromosomeD05:47891744..47891996 +
A05chromosomeA05:54620934..54621216 -
CM018219.1chromosomeCM018219.1:47306514..47306766 +
CM018206.1chromosomeCM018206.1:62575520..62575772 -
D5_05chromosomeD5_05:43419219..43419465 +
KI_05chromosomeKI_05:32455694..32455946 -
Chr10chromosomeChr10:92857375..92857633 -
Chr05_CRI-A2_v1.0.a1chromosomeChr05_CRI-A2_v1.0.a1:76832124..76832382 -
scaffold222supercontigscaffold222:160717..160963 +
D10_05chromosomeD10_05:15339031..15339277 -
CM016618.1chromosomeCM016618.1:26262390..26262642 -
Dt_chr9chromosomeDt_chr9:22332115..22332367 +
At_chr3chromosomeAt_chr3:1227843..1228113 -
D05chromosomeD05:46703556..46703808 +
A05chromosomeA05:49494578..49494860 -
Ghir_D05chromosomeGhir_D05:47663084..47663336 +
Ghir_A05chromosomeGhir_A05:67092220..67092502 +
D05chromosomeD05:48748324..48748576 +
A05chromosomeA05:68697859..68698141 -
D05chromosomeD05:49424786..49425038 +
A05chromosomeA05:67478073..67478343 -
D05chromosomeD05:48178655..48178907 +
A05chromosomeA05:66447776..66448058 -
Dt05chromosomeDt05:49846080..49846332 +
At05chromosomeAt05:48940461..48940713 -
scaffold9167supercontigscaffold9167:208286..208538 +
scaffold5512supercontigscaffold5512:215585..215837 -
Gbar_D05chromosomeGbar_D05:44952632..44952884 -
Gbar_A05chromosomeGbar_A05:63090834..63091086 -
D05chromosomeD05:49614858..49615110 +
A05chromosomeA05:65595924..65596176 -
CM017627.1chromosomeCM017627.1:48554746..48554998 +
CM017614.1chromosomeCM017614.1:64553917..64554169 -
CM017653.1chromosomeCM017653.1:49682896..49683154 +
CM017640.1chromosomeCM017640.1:68435857..68436100 -
CM017705.1chromosomeCM017705.1:48844565..48844817 +
CM017692.1chromosomeCM017692.1:64651290..64651542 -
Chr09chromosomeNAU4031:1..834 .
Chr09:43771043..43771876 -
scaffold222supercontigNAU4031:1..834 .
scaffold222:160304..161137 -
Sequence
>NAU4031 ID=NAU4031|Name=NAU4031|organism=Gossypium raimondii|type=genetic_marker|length=247bp
TAATGCTAGGTTGCTGGACAGGCATGTTGTAAGCTTGAGGCTGCCTCGCG
GACACATAATACAGGGGATATTGCTGATCAATCTGTGTTTGATGATGGTG
ATGTTGCTGTTGGGAAGGATATACAGGATAATAAGCTGAGATCGGCACTG
CCCCAGACTGGTGATGATGAATGTAATGCGGTGCACCAGCAGCATGCAAG
AACTGCTGCTGCTGCTGCTGCTGCTGTGGTTGTTGCTGTTGATCAAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A05-2N/AAD_chr.0585.9NAU4031
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.0520NAU4031
3(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr05-2N/AAD_chr.05113.1NAU4031
4Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.0594.6NAU4031
5W10 x TM-1, F2:3 (2015)WT-F2:3_chr05-1N/AAD_chr.0534.8NAU4031
60-153 x sGK9708, RIL (2016)0s-RIL_chr05-2N/AAD_chr.0597.6NAU4031
70-153 x sGK9708, RIL (2017)0s-RIL.17_chr05N/AAD_chr.0562.45NAU4031
8MGG-293-793, MAGIC (2018)MAGIC-19831_chr02N/AAD_chr.02175.1NAU4031
9MGG-293-793, MAGIC (2018)MAGIC-19831_chr05N/AAD_chr.05175.1NAU4031
10901-001 x sGK156, F2 (2019)Chr05N/AAD_chr.050NAU4031b
11901-001 x sGK156, F2 (2019)Chr05N/AAD_chr.055.93NAU4031a