NAU3991, NAU3991 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU3991
Genbank IDCO127902
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(gtt)6
PCR ConditionAnnealing temperature: 57
Primer 1NAU3991_F: TCCTCCCGGGTTTTACTAAT
Primer 2NAU3991_R: CCACATCGACATTCAAACAT
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO127902
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3991_FNAU3991_FGossypium raimondiiprimer
NAU3991_RNAU3991_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3991aNAU3991aGossypium raimondiimarker_locus
NAU3991bNAU3991bGossypium raimondiimarker_locus
nau3991nau3991Gossypium raimondiimarker_locus
NAU3991-230NAU3991-230Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D13chromosomeD13:63214006..63214235 -
D13chromosomeD13:63177553..63177782 -
A13chromosomeA13:103276796..103277029 -
CM018227.1chromosomeCM018227.1:58810072..58810300 -
D5_13chromosomeD5_13:57654618..57654848 -
Chr13chromosomeChr13:1826761..1826991 -
D10_13chromosomeD10_13:59605012..59605243 -
At_chr4chromosomeAt_chr4:37759280..37759509 +
At_chr4chromosomeAt_chr4:37795602..37795831 +
At_chr6chromosomeAt_chr6:45420291..45420525 -
D13chromosomeD13:58999743..58999972 -
D13chromosomeD13:58963317..58963546 -
A13chromosomeA13:78724910..78725144 -
Ghir_D13chromosomeGhir_D13:61758377..61758606 -
Ghir_D13chromosomeGhir_D13:61721943..61722172 -
Ghir_A13chromosomeGhir_A13:107012516..107012751 -
D13chromosomeD13:62956965..62957194 -
D13chromosomeD13:62920814..62921043 -
D13chromosomeD13:62337715..62337944 -
D13chromosomeD13:62301246..62301475 -
A13chromosomeA13:107338379..107338612 -
D13chromosomeD13:58596036..58596265 -
D13chromosomeD13:58559563..58559792 -
A13chromosomeA13:106057397..106057631 -
scaffold50836supercontigscaffold50836:5776..6005 +
Gbar_D13chromosomeGbar_D13:58730968..58731196 -
D13chromosomeD13:59701767..59701995 -
CM017635.1chromosomeCM017635.1:59794028..59794256 -
CM017635.1chromosomeCM017635.1:59757580..59757809 -
CM017622.1chromosomeCM017622.1:109125726..109125961 -
CM017661.1chromosomeCM017661.1:63028190..63028412 -
CM017648.1chromosomeCM017648.1:114423078..114423305 -
CM017713.1chromosomeCM017713.1:59504616..59504844 -
CM017713.1chromosomeCM017713.1:59468259..59468487 -
CM017700.1chromosomeCM017700.1:109169085..109169319 -
Sequence
>NAU3991 ID=NAU3991|Name=NAU3991|organism=Gossypium raimondii|type=genetic_marker|length=231bp
TCCTCCCGGGTTTTACTAATTGTAAGTATGTTGAGCTTTTAACGATTATC
ATGTCCCATAAGTTTGTATTAGTAGGACATGATTGTTTTGATTTTGCATT
GGTGTTTTTCATCTTTTTTTCCCGCTTAAAAATACCAAGGCATTGTTTTT
TTTTTTGTTGTTGTTGTTGTTGTTTCCCTTTTGAATTGACTAAATTTATT
TAGGACAAACAATGTTTGAATGTCGATGTGG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr13N/AAD_chr.1321.73NAU3991a
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr18N/AAD_chr.188.82NAU3991b
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr18N/AAD_chr.182nau3991
4Li2 x DP5690, F2 (2011)Li2D-F2_chr18N/AAD_chr.180.87nau3991
5Yumian-1 x T586, RIL (2015)YT-RIL.15_chr18N/AAD_chr.18101.7nau3991
6Yumian-1 x 7235, RIL (2015)Y7-RIL_chr18N/AAD_chr.1858.3nau3991
7CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr13N/AAt.1314.5nau3991
8TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr18N/AAD_chr.182.5NAU3991-230
9TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr18/D13N/AAD_chr.182.54NAU3991-230