NAU3485, NAU3485 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU3485
Genbank IDCO108192
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(gct)4(gtt)6
PCR ConditionAnnealing temperature: 57
Primer 1NAU3485_F: GTTCAAAGTCGGGTTATTGG
Primer 2NAU3485_R: AGTGCAACGGCTTAGGATAC
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO108192
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3485_FNAU3485_FGossypium raimondiiprimer
NAU3485_RNAU3485_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3485aNAU3485aGossypium raimondiimarker_locus
NAU3485bNAU3485bGossypium raimondiimarker_locus
NAU3485NAU3485Gossypium raimondiimarker_locus
NAU3485-205NAU3485-205Gossypium raimondiimarker_locus
NAU3485-195NAU3485-195Gossypium raimondiimarker_locus
NAU3485NAU3485-79.7Gossypium raimondiimarker_locus
NAU3485bNAU3485b-13.1Gossypium raimondiimarker_locus
NAU3485aNAU3485a-14.2Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D02chromosomeD02:10500684..10500879 +
A02chromosomeA02:11200281..11200488 -
CM018216.1chromosomeCM018216.1:9718417..9718606 +
CM018203.1chromosomeCM018203.1:10502080..10502278 -
D5_03chromosomeD5_03:54253411..54253612 -
KI_03chromosomeKI_03:6458786..6458981 -
Chr9chromosomeChr9:68616956..68617166 +
Chr03_CRI-A2_v1.0.a1chromosomeChr03_CRI-A2_v1.0.a1:11946161..11946371 -
Chr5chromosomeChr5:4872624..4872825 +
D10_03chromosomeD10_03:55601436..55601636 +
D10_03chromosomeD10_03:55606786..55606984 -
CM016616.1chromosomeCM016616.1:138782108..138782312 +
Dt_chr5chromosomeDt_chr5:50485778..50485973 -
At_chr3chromosomeAt_chr3:41504089..41504296 -
D02chromosomeD02:10184340..10184535 +
A02chromosomeA02:10797181..10797388 -
Ghir_D02chromosomeGhir_D02:10012589..10012784 +
Ghir_A02chromosomeGhir_A02:10767001..10767208 -
D02chromosomeD02:9686377..9686572 +
A02chromosomeA02:10387950..10388157 -
D02chromosomeD02:10054110..10054305 +
A02chromosomeA02:11023291..11023498 -
D02chromosomeD02:10014068..10014263 +
A02chromosomeA02:11003044..11003251 -
Dt02chromosomeDt02:8946775..8946964 +
Dt02chromosomeDt02:8945171..8945340 +
Dt02chromosomeDt02:8952119..8952317 -
Dt02chromosomeDt02:8963919..8964110 -
scaffold5982supercontigscaffold5982:73396..73585 +
scaffold5982supercontigscaffold5982:71792..71961 +
scaffold185supercontigscaffold185:141228..141426 +
scaffold5982supercontigscaffold5982:78740..78938 -
scaffold5982supercontigscaffold5982:90540..90731 -
Gbar_D02chromosomeGbar_D02:10228963..10229152 +
Gbar_A02chromosomeGbar_A02:10604805..10605003 -
D02chromosomeD02:9684023..9684212 +
A02chromosomeA02:10522186..10522384 -
CM017624.1chromosomeCM017624.1:10374203..10374398 +
CM017624.1chromosomeCM017624.1:10379552..10379723 -
CM017611.1chromosomeCM017611.1:10580997..10581192 -
CM017650.1chromosomeCM017650.1:10648227..10648422 +
CM017637.1chromosomeCM017637.1:11055056..11055254 -
CM017702.1chromosomeCM017702.1:10219611..10219806 +
CM017689.1chromosomeCM017689.1:10693780..10693981 -
Sequence
>NAU3485 ID=NAU3485|Name=NAU3485|organism=Gossypium raimondii|type=genetic_marker|length=202bp
GTTCAAAGTCGGGTTATTGGCGGATGAATGAGGCATCTGCAGCTGCTGCT
GCTGTTGTTGTTGTTGTTGTTGCGGTGTCTGCAGGACGCCAAAGTGATGT
GGAGCAGGTTGGTGGGTTGAATATTGAGGAGATAGTCCTCTATTGAAAGG
ATTTCCATTCATAGCAGACACTTGACCAGCTTGTATCCTAAGCCGTTGCA
CT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr02N/AAD_chr.0270.58NAU3485aView
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr14N/AAD_chr.1452.11NAU3485bView
3Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A02N/AA_chr.0285.3NAU3485View
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr14N/AAD_chr.1462NAU3485View
5AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.02139NAU3485View
6CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr02N/AAt.0244.1NAU3485View
7CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr14N/ADt.0261.7NAU3485View
8TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr02N/AAD_chr.0267NAU3485-205View
9TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr02/A2N/AAD_chr.0255.69NAU3485-205View
10TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr14N/AAD_chr.1470.3NAU3485-195View
11TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr14/D2N/AAD_chr.1470.37NAU3485-195View
12CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr02N/AAt.0279.7NAU3485View
13PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr02-1N/AAt.0213.1NAU3485bView
14PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr02-1N/AAt.0214.2NAU3485aView
Image
File NameLegend
48_FISH_TAG-115-675.jpgTwenty-six individual cotton mitotic chromosomes with FISH signals derived from the chromosome-speciWc BACs, and comparisons of linkage and FISH maps. [Image from Wang 2007, TAG-115-675]