NAU3287, NAU3287 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU3287
Genbank IDCO100370
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(attt)4
PCR ConditionAnnealing temperature: 57
Primer 1NAU3287_F: AAAACGCCAAATTTATCCAG
Primer 2NAU3287_R: AGGACATGCCAAATACGAGT
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO100370
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3287_FNAU3287_FGossypium raimondiiprimer
NAU3287_RNAU3287_RGossypium raimondiiprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqUHML.CY-RIL_ch08.swu12Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3287NAU3287Gossypium raimondiimarker_locus
NAU3287NAU3287-128.644Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D08chromosomeD08:67326617..67326859 +
A08chromosomeA08:121099705..121099948 +
CM018222.1chromosomeCM018222.1:63225201..63225438 +
CM018209.1chromosomeCM018209.1:116457819..116458062 +
D5_08chromosomeD5_08:59246010..59246253 +
KI_08chromosomeKI_08:37442855..37443094 +
Chr3chromosomeChr3:40573057..40573300 -
Chr08_CRI-A2_v1.0.a1chromosomeChr08_CRI-A2_v1.0.a1:126727610..126727853 +
Chr4chromosomeChr4:1990634..1990877 -
D10_08chromosomeD10_08:2140579..2140823 -
Dt_chr5chromosomeDt_chr5:12567137..12567379 +
scaffold246.1supercontigscaffold246.1:1266106..1266349 -
D08chromosomeD08:63735991..63736233 +
A08chromosomeA08:101003836..101004079 +
Ghir_D08chromosomeGhir_D08:66211031..66211273 +
Ghir_A08chromosomeGhir_A08:119990194..119990437 +
D08chromosomeD08:66506155..66506397 +
A08chromosomeA08:122560072..122560315 +
D08chromosomeD08:66057219..66057461 +
A08chromosomeA08:122879094..122879337 +
D08chromosomeD08:63353364..63353606 +
A08chromosomeA08:118572285..118572528 +
At08chromosomeAt08:105784188..105784431 +
scaffold1843supercontigscaffold1843:395795..396038 +
scaffold19977supercontigscaffold19977:4562..4799 -
Gbar_D08chromosomeGbar_D08:63358648..63358885 +
Gbar_A08chromosomeGbar_A08:117138864..117139107 +
D08chromosomeD08:65096476..65096713 +
A08chromosomeA08:118089169..118089412 +
CM017630.1chromosomeCM017630.1:64920245..64920487 +
CM017617.1chromosomeCM017617.1:116655089..116655332 +
CM017656.1chromosomeCM017656.1:67059969..67060212 +
CM017643.1chromosomeCM017643.1:126414523..126414766 +
CM017708.1chromosomeCM017708.1:63621227..63621464 +
CM017695.1chromosomeCM017695.1:117380963..117381206 +
Chr4chromosomeNAU3287:1..848 .
Chr4:1990425..1991272 +
Chr04chromosomeNAU3287:1..848 .
Chr04:59725733..59726580 -
Sequence
>NAU3287 ID=NAU3287|Name=NAU3287|organism=Gossypium raimondii|type=genetic_marker|length=244bp
AAAACGCCAAATTTATCCAGAACAACAATTTATTTATTTATTTTTGTTAT
TTTATTATTTTCTAAGGCTACCCCTAACACCAGGACGAGGCTTAGATGGC
TCAGCGACATGAACAGCATGACGATTAATAAGCTTAGATTCTTCAAAAGG
AATTTTGGGATGTTTGGCATCATGATGGATCTGCATCGATTTCACATCGG
GAGCGGTTGTTTTGCAATGAGGACACTCGTATTTGGCATGTCCT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr24N/AAD_chr.24113.23NAU3287View
260182 x Jun Mian 1, F2:3 (2007)6J-F2:3_chr16N/AAD_chr.1660.9NAU3287View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr08N/AAD_chr.0861.4NAU3287View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr08N/AAt.08128.64NAU3287View