NAU3273, NAU3273 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU3273
Genbank IDCO099903
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(tca)6
PCR ConditionAnnealing temperature: 57
Primer 1NAU3273_F: ATTATCGGGAGAGGACATGA
Primer 2NAU3273_R: GAGATTGCAGTGGCTCCTAT
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO099903
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3273_FNAU3273_FGossypium raimondiiprimer
NAU3273_RNAU3273_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3273NAU3273Gossypium raimondiimarker_locus
NAU3273-250NAU3273-250Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D04chromosomeD04:5450960..5451154 +
A05chromosomeA05:94586671..94586862 -
CM018218.1chromosomeCM018218.1:4928789..4928983 +
CM018206.1chromosomeCM018206.1:97000894..97001085 -
D5_04chromosomeD5_04:45337750..45337950 -
KI_06chromosomeKI_06:46350639..46350821 +
Chr12chromosomeChr12:80359800..80359991 +
Chr04_CRI-A2_v1.0.a1chromosomeChr04_CRI-A2_v1.0.a1:92503873..92504064 -
Chr12chromosomeChr12:21390416..21390616 -
D10_04chromosomeD10_04:4771548..4771748 +
At_chr9chromosomeAt_chr9:62579429..62579623 -
At_chr9chromosomeAt_chr9:62577990..62578184 -
At_chr9chromosomeAt_chr9:59996920..59997111 -
D04chromosomeD04:4702619..4702813 +
A05chromosomeA05:86337524..86337715 -
Ghir_D04chromosomeGhir_D04:5364712..5364906 +
Ghir_A05chromosomeGhir_A05:103438158..103438349 -
D04chromosomeD04:5289993..5290187 +
A05chromosomeA05:105047399..105047590 -
D04chromosomeD04:5232128..5232322 +
A05chromosomeA05:103540621..103540812 -
D04chromosomeD04:4973000..4973194 +
A05chromosomeA05:101477764..101477955 -
Dt04chromosomeDt04:4818640..4818834 +
scaffold2596supercontigscaffold2596:153495..153689 +
scaffold2596supercontigscaffold2596:155144..155335 +
scaffold23232supercontigscaffold23232:41990..42184 +
Gbar_D04chromosomeGbar_D04:4919066..4919260 +
Gbar_A05chromosomeGbar_A05:97018204..97018395 -
D04chromosomeD04:4896802..4896996 +
A05chromosomeA05:101969692..101969883 -
CM017626.1chromosomeCM017626.1:5039206..5039400 +
CM017614.1chromosomeCM017614.1:99282660..99282851 -
CM017652.1chromosomeCM017652.1:5187123..5187317 +
CM017640.1chromosomeCM017640.1:107701448..107701639 -
CM017704.1chromosomeCM017704.1:5191377..5191571 +
CM017692.1chromosomeCM017692.1:99891924..99892115 -
Chr12chromosomeNAU3273:1..878 .
Chr12:4883105..4884137 -
Chr12chromosomeNAU3273:1..878 .
Chr12:21390030..21391062 +
Sequence
>NAU3273 ID=NAU3273|Name=NAU3273|organism=Gossypium raimondii|type=genetic_marker|length=201bp
ATTATCGGGAGAGGACATGACCTTATCTTCTTTTCCACCTGACTTACTAA
CAGCCAACTTTTCATCTCCATCAGTGTTGCATGCATCACCATCACCATCA
TCACTTCCATCATCATCATCATCATCACCATCACCATCAGCCCCATCATC
ATCTTCATCTTCATCATAAACAATGCCTTTTATAGGAGCCACTGCAATCT
C
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A05-2N/AAD_chr.0523.6NAU3273
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.05294NAU3273
3Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch05/A05-2N/AAD_chr.0573.7NAU3273
4Yumian-1 x T586, RIL (2015)YT-RIL.15_chr05N/AAD_chr.05103NAU3273
5TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr05/A5N/AAD_chr.05168.44NAU3273-250
6TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr05N/AAD_chr.05180.7NAU3273-250