NAU3053, NAU3053 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU3053
AliasHAU1129=NAU3053
NAU3053=HAU1129
HAU1129
Genbank IDCO090925
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(at)13
PCR ConditionAnnealing temperature: 57
Primer 1NAU3053_F: TTGGAGGTGTCAGATCCTCT
Primer 2NAU3053_R: AAGATCCATGACCCAGAAAA
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO090925
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3053_FNAU3053_FGossypium raimondiiprimer
NAU3053_RNAU3053_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3053NAU3053Gossypium raimondiimarker_locus
NAU3053-190NAU3053-190Gossypium raimondiimarker_locus
NAU3053/180y(C26)NAU3053/180y(C26)Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D07chromosomeD07:3952161..3952342 -
A07chromosomeA07:3836731..3836902 -
CM018221.1chromosomeCM018221.1:3650839..3651022 -
CM018208.1chromosomeCM018208.1:4157379..4157550 -
D5_07chromosomeD5_07:3632140..3632331 -
Chr1chromosomeChr1:49211451..49211622 +
Chr07_CRI-A2_v1.0.a1chromosomeChr07_CRI-A2_v1.0.a1:4194387..4194558 -
Chr1chromosomeChr1:34204854..34205037 -
D10_07chromosomeD10_07:50169987..50170151 +
CM016620.1chromosomeCM016620.1:110875221..110875387 +
Dt_chr1chromosomeDt_chr1:42224990..42225171 +
D07chromosomeD07:3460341..3460522 -
A07chromosomeA07:3344619..3344790 -
Ghir_D07chromosomeGhir_D07:3934539..3934716 -
Ghir_A07chromosomeGhir_A07:4145998..4146169 -
D07chromosomeD07:3783313..3783494 -
A07chromosomeA07:3882411..3882582 -
D07chromosomeD07:3894693..3894874 -
A07chromosomeA07:4132057..4132228 -
D07chromosomeD07:3720771..3720952 -
A07chromosomeA07:4165506..4165677 -
At07chromosomeAt07:3153932..3154103 -
At07chromosomeAt07:3152903..3153074 -
scaffold2826supercontigscaffold2826:81495..81666 -
scaffold2826supercontigscaffold2826:80466..80637 -
Gbar_D07chromosomeGbar_D07:3885719..3885902 -
Gbar_A07chromosomeGbar_A07:4144481..4144652 -
D07chromosomeD07:3842036..3842219 -
A07chromosomeA07:4035471..4035642 -
CM017629.1chromosomeCM017629.1:4074281..4074456 -
CM017616.1chromosomeCM017616.1:3976917..3977088 -
CM017655.1chromosomeCM017655.1:3944955..3945128 -
CM017642.1chromosomeCM017642.1:4145681..4145852 -
CM017707.1chromosomeCM017707.1:3875838..3876021 -
CM017694.1chromosomeCM017694.1:4108924..4109095 -
Sequence
>NAU3053 ID=NAU3053|Name=NAU3053|organism=Gossypium raimondii|type=genetic_marker|length=190bp
TTGGAGGTGTCAGATCCTCTGATTGAAGATTTGACGACCCTTTGGTTCCT
CAAATATTGTGGTATGCATTTGTAGATGGGTTAGAGAAGGAATGAATTGA
CATATATATATATATATATATATATATTATATGCCCCCCCACATTATGAC
AAAATAGCATGTACAGAATGTTTTCTGGGTCATGGATCTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Hai-7124 x Junmian-1, BC1 (2008) partHai-7124 x Junmian-1, BC1 (2008) part.HJ-BC1_chr07N/AAD_chr.0728.9NAU3053
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.1610NAU3053
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr07N/AAD_chr.07189NAU3053
4Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr16N/AAD_chr.16102.99NAU3053
5Yumian-1 x T586, RIL (2006)YT-RIL_chr16-1N/AAD_chr.1612.2NAU3053
6H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.160NAU3053
760182 x Jun Mian 1, F2:3 (2007)6J-F2:3_chr16N/AAD_chr.1645.3NAU3053
8Yumian-1 x T586, RIL (2015)YT-RIL.15_chr16N/AAD_chr.1612.7NAU3053
9Prema x 86-1, RIL (2015)P8-RIL_chr16.1N/AAD_chr.160NAU3053
10TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr16N/AAD_chr.16112.1NAU3053
11SG 747 x Giza 75, BIL (2013)SG-BIL_chr16N/AAD_chr.1622.8NAU3053
12TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.1630.8NAU3053-190
13TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1630.68NAU3053-190
14H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1630.7NAU3053-190
15Yumian-1 x T586, RIL (2009)YT-RIL_chr16-1N/AAD_chr.1645.1NAU3053/180y(C26)