NAU2931, NAU2931 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU2931
Genbank IDCO085347
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(cag)8
PCR ConditionAnnealing temperature: 57
Primer 1NAU2931_F: CCGATTGGGAAACTAAGAAA
Primer 2NAU2931_R: CACCTTGTTGATGATGAGGA
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO085347
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2931_FNAU2931_FGossypium raimondiiprimer
NAU2931_RNAU2931_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2931NAU2931Gossypium raimondiimarker_locus
NAU2931-180NAU2931-180Gossypium raimondiimarker_locus
NAU2931NAU2931-48.849Gossypium raimondiimarker_locus
NAU2931NAU2931-28Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D07chromosomeD07:7301510..7301698 +
A07chromosomeA07:7708254..7708430 +
CM018221.1chromosomeCM018221.1:6912523..6912699 +
CM018208.1chromosomeCM018208.1:7920636..7920815 +
D5_07chromosomeD5_07:6863379..6863558 +
KI_07chromosomeKI_07:32307438..32307611 -
Chr8chromosomeChr8:97650985..97651161 -
Chr07_CRI-A2_v1.0.a1chromosomeChr07_CRI-A2_v1.0.a1:8035810..8035986 +
Chr1chromosomeChr1:31004607..31004786 -
D10_07chromosomeD10_07:47000191..47000379 -
CM016620.1chromosomeCM016620.1:105759753..105759923 -
scaffold120.1supercontigscaffold120.1:1226572..1226748 -
Dt_chr1chromosomeDt_chr1:37199839..37200021 -
D07chromosomeD07:6844228..6844416 +
A07chromosomeA07:7037245..7037421 +
Ghir_D07chromosomeGhir_D07:7149495..7149683 +
Ghir_A07chromosomeGhir_A07:8024972..8025148 +
D07chromosomeD07:6853904..6854092 +
A07chromosomeA07:7587077..7587253 +
D07chromosomeD07:7100283..7100471 +
A07chromosomeA07:7990184..7990360 +
D07chromosomeD07:6954233..6954421 +
A07chromosomeA07:8059876..8060052 +
Dt07chromosomeDt07:7621298..7621474 +
Dt07chromosomeDt07:7625764..7625940 +
scaffold9309supercontigscaffold9309:74920..75096 +
scaffold9309supercontigscaffold9309:79386..79562 +
scaffold5151supercontigscaffold5151:178897..179073 -
Scaffold1510supercontigScaffold1510:12901..13077 +
Gbar_A07chromosomeGbar_A07:7878651..7878827 +
D07chromosomeD07:7057057..7057233 +
A07chromosomeA07:7696643..7696816 +
CM017629.1chromosomeCM017629.1:7333397..7333582 +
CM017616.1chromosomeCM017616.1:7698982..7699158 +
CM017655.1chromosomeCM017655.1:7303159..7303347 +
CM017642.1chromosomeCM017642.1:7898435..7898611 +
CM017707.1chromosomeCM017707.1:7175040..7175216 +
CM017694.1chromosomeCM017694.1:7812057..7812233 +
Sequence
>NAU2931 ID=NAU2931|Name=NAU2931|organism=Gossypium raimondii|type=genetic_marker|length=180bp
CCGATTGGGAAACTAAGAAAGTAAAGAAGAAAAAGAAAACACAGCAACAG
CAGCAGCAGCAGCAGCAGCAGGAGCAAGAAAAGAAGAAGAAGAAGAAAAA
GAAGAAAAGTAGTAAACTTGTTGTTGGCAATGAGAGCAGCAACAGCCATA
AGGTGCATCATCCTCATCATCAACAAGGTG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.1614NAU2931
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr16N/AAD_chr.1688.68NAU2931
3H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.1619.8NAU2931
4Yumian-1 x 7235, RIL (2015)Y7-RIL_chr16N/AAD_chr.16108NAU2931
5DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr07-2N/AAD_chr.07107.54NAU2931
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr16N/AAD_chr.16107.54NAU2931
7TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr16N/AAD_chr.1690.3NAU2931
8DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr16N/AAD_chr.160NAU2931
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr16N/ADt.07105.2NAU2931
10CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr16N/AAD_chr.1676.2NAU2931
11TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.1647.5NAU2931-180
12TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1647.65NAU2931-180
13H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1647.6NAU2931-180
14CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr16N/ADt.0748.85NAU2931
15MGG-293-793, MAGIC (2018)MAGIC-19831_chr16N/AAD_chr.1628NAU2931