NAU2862, NAU2862 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU2862
Genbank IDCO082765
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(ctt)5
PCR ConditionAnnealing temperature: 57
Primer 1NAU2862_F: CAACAGCATCAGCTGAAAAC
Primer 2NAU2862_R: AAGAAAACACAGCAACAGCA
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO082765
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2862_FNAU2862_FGossypium raimondiiprimer
NAU2862_RNAU2862_RGossypium raimondiiprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
lint yieldqLY.DJiM-RIL_ch16.h13Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2862NAU2862Gossypium raimondiimarker_locus
NAU2862-275NAU2862-275Gossypium raimondiimarker_locus
NAU2862-330NAU2862-330Gossypium raimondiimarker_locus
NAU2862aNAU2862aGossypium raimondiimarker_locus
NAU2862bNAU2862bGossypium raimondiimarker_locus
NAU2862NAU2862-48.849Gossypium raimondiimarker_locus
NAU2862NAU2862-48.9Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D07chromosomeD07:7301542..7301794 -
A07chromosomeA07:7708286..7708526 -
CM018221.1chromosomeCM018221.1:6912555..6912795 -
CM018208.1chromosomeCM018208.1:7920668..7920911 -
D5_07chromosomeD5_07:6863411..6863654 -
KI_07chromosomeKI_07:32307282..32307579 +
Chr8chromosomeChr8:97650889..97651129 +
Chr07_CRI-A2_v1.0.a1chromosomeChr07_CRI-A2_v1.0.a1:8035842..8036082 -
Chr1chromosomeChr1:31004511..31004754 +
D10_07chromosomeD10_07:47000095..47000347 +
CM016620.1chromosomeCM016620.1:105759657..105759891 +
scaffold120.1supercontigscaffold120.1:1226476..1226716 +
Dt_chr1chromosomeDt_chr1:37199743..37199995 +
D07chromosomeD07:6844260..6844512 -
A07chromosomeA07:7037277..7037517 -
Ghir_D07chromosomeGhir_D07:7149527..7149779 -
Ghir_A07chromosomeGhir_A07:8025004..8025244 -
D07chromosomeD07:6853936..6854188 -
A07chromosomeA07:7587109..7587349 -
D07chromosomeD07:7100315..7100567 -
A07chromosomeA07:7990216..7990456 -
D07chromosomeD07:6954265..6954517 -
A07chromosomeA07:8059908..8060148 -
Dt07chromosomeDt07:7621330..7621570 -
Dt07chromosomeDt07:7625796..7626036 -
scaffold5151supercontigscaffold5151:178801..179041 +
scaffold9309supercontigscaffold9309:74952..75192 -
scaffold9309supercontigscaffold9309:79418..79658 -
Scaffold1510supercontigScaffold1510:12933..13173 -
Gbar_A07chromosomeGbar_A07:7878683..7878923 -
D07chromosomeD07:7057089..7057329 -
A07chromosomeA07:7696675..7696912 -
CM017629.1chromosomeCM017629.1:7333429..7333678 -
CM017616.1chromosomeCM017616.1:7699014..7699254 -
CM017655.1chromosomeCM017655.1:7303191..7303443 -
CM017642.1chromosomeCM017642.1:7898467..7898707 -
CM017707.1chromosomeCM017707.1:7175072..7175312 -
CM017694.1chromosomeCM017694.1:7812089..7812329 -
Chr1chromosomeNAU2862:1..869 .
Chr1:31004431..31005299 -
Chr01chromosomeNAU2862:1..869 .
Chr01:6790341..6791209 +
Sequence
>NAU2862 ID=NAU2862|Name=NAU2862|organism=Gossypium raimondii|type=genetic_marker|length=244bp
CAACAGCATCAGCTGAAAACCCAATTCCAGGTCCACACCAAACATCTTGA
ATCACTCCACAACTAATGTTATAACCACTCCCTTCATTCAAAAGCACACC
TTGTTGATGATGAGGATGATGCACCTTATGGCTGTTGCTGCTCTCATTGC
CAACAACAAGTTTACTACTTTTCTTCTTTTTCTTCTTCTTCTTCTTTTCT
TGCTCCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGTGTTTTCTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Hai-7124 x Junmian-1, BC1 (2008) partHai-7124 x Junmian-1, BC1 (2008) part.HJ-BC1_chr07N/AAD_chr.0768.3NAU2862
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.1615NAU2862
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr07N/AAD_chr.07163NAU2862
4H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.1620.2NAU2862
5Prema x 86-1, RIL (2015)P8-RIL_chr16.2N/AAD_chr.160.57NAU2862
6Yumian-1 x 7235, RIL (2015)Y7-RIL_chr16N/AAD_chr.1650NAU2862
7DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr07-2N/AAD_chr.07106.75NAU2862
8DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr16N/AAD_chr.16106.75NAU2862
9DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr16N/AAD_chr.167NAU2862
10CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr16N/AAD_chr.1676NAU2862
11TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr07N/AAD_chr.0738.4NAU2862-275
12TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr07/A7N/AAD_chr.0739.61NAU2862-275
13TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.1647.6NAU2862-330
14TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1647.73NAU2862-330
15H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1647.7NAU2862-330
16(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr16-1N/AAD_chr.1639.2NAU2862a
17(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr16-1N/AAD_chr.1643.4NAU2862b
18CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr16N/ADt.0748.85NAU2862
19PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr16-1N/ADt.0748.9NAU2862