NAU2741, NAU2741 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU2741
Genbank IDCO077579
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(ttc)7
PCR ConditionAnnealing temperature: 57
Primer 1NAU2741_F: AGTCCACGTCCACAGACTTT
Primer 2NAU2741_R: GGCACCTTGGAATACATCTC
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO077579
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2741_FNAU2741_FGossypium raimondiiprimer
NAU2741_RNAU2741_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2741bNAU2741bGossypium raimondiimarker_locus
NAU2741aNAU2741aGossypium raimondiimarker_locus
nau2741nau2741Gossypium raimondiimarker_locus
NAU2741-300NAU2741-300Gossypium raimondiimarker_locus
NAU2741-400NAU2741-400Gossypium raimondiimarker_locus
NAU2741/220y(C1,C19)NAU2741/220y(C1,C19)Gossypium raimondiimarker_locus
NAU2741NAU2741-54.033Gossypium raimondiimarker_locus
NAU2741NAU2741-84.7Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D05chromosomeD05:21746056..21746319 +
A05chromosomeA05:23643229..23643506 +
A01chromosomeA01:96928778..96929017 +
D01chromosomeD01:59538287..59538525 -
CM018219.1chromosomeCM018219.1:20513897..20514171 +
CM018206.1chromosomeCM018206.1:22720649..22720926 +
CM018202.1chromosomeCM018202.1:106091910..106092152 +
CM018215.1chromosomeCM018215.1:58196359..58196597 -
D5_05chromosomeD5_05:19295434..19295708 +
D5_01chromosomeD5_01:51547684..51547922 +
KI_05chromosomeKI_05:17215099..17215372 +
KI_01chromosomeKI_01:34161999..34162241 +
Chr10chromosomeChr10:23421860..23422137 +
Chr2chromosomeChr2:42861898..42862137 -
Chr05_CRI-A2_v1.0.a1chromosomeChr05_CRI-A2_v1.0.a1:23385183..23385460 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:92122233..92122472 +
Chr9chromosomeChr9:10574961..10575199 +
Chr9chromosomeChr9:24547743..24548017 -
D10_05chromosomeD10_05:41095459..41095733 -
D10_01chromosomeD10_01:5407981..5408219 -
CM016614.1chromosomeCM016614.1:128864994..128865236 +
CM016618.1chromosomeCM016618.1:88857833..88858107 -
Dt_chr2chromosomeDt_chr2:9041655..9041893 +
At_chr8chromosomeAt_chr8:22372130..22372369 +
Dt_chr9chromosomeDt_chr9:47223200..47223463 -
D05chromosomeD05:20922577..20922840 +
A05chromosomeA05:21118363..21118640 +
A01chromosomeA01:92967381..92967620 +
D01chromosomeD01:56786007..56786245 -
Ghir_D05chromosomeGhir_D05:21049726..21049989 +
Ghir_A05chromosomeGhir_A05:23269679..23269956 +
Ghir_A01chromosomeGhir_A01:110489155..110489394 +
Ghir_D01chromosomeGhir_D01:58456740..58456978 -
D05chromosomeD05:20569003..20569266 +
A05chromosomeA05:22614924..22615201 +
A01chromosomeA01:111159522..111159761 +
D01chromosomeD01:60074493..60074731 -
D05chromosomeD05:20903100..20903363 +
A05chromosomeA05:23324550..23324827 +
A01chromosomeA01:108784872..108785111 +
D01chromosomeD01:59869837..59870075 -
D05chromosomeD05:20784417..20784680 +
A05chromosomeA05:23468937..23469214 +
A01chromosomeA01:105557347..105557589 +
D01chromosomeD01:57106312..57106550 -
At05chromosomeAt05:18283380..18283657 +
At05chromosomeAt05:18282063..18282337 +
Dt01chromosomeDt01:57558044..57558282 -
Dt01chromosomeDt01:57556893..57557131 -
scaffold9246supercontigscaffold9246:76789..77066 +
scaffold9246supercontigscaffold9246:75472..75746 +
scaffold2395supercontigscaffold2395:125120..125359 -
scaffold2395supercontigscaffold2395:126495..126737 -
scaffold20973supercontigscaffold20973:17285..17523 -
scaffold20973supercontigscaffold20973:16134..16372 -
Gbar_D05chromosomeGbar_D05:20876651..20876925 +
Gbar_A05chromosomeGbar_A05:22395299..22395576 +
Gbar_A01chromosomeGbar_A01:108533381..108533623 +
Gbar_D01chromosomeGbar_D01:58418977..58419215 -
D05chromosomeD05:20876907..20877181 +
A05chromosomeA05:23081184..23081461 +
A01chromosomeA01:108491301..108491543 +
D01chromosomeD01:59072383..59072621 -
CM017627.1chromosomeCM017627.1:20749223..20749497 +
CM017614.1chromosomeCM017614.1:22888560..22888837 +
CM017610.1chromosomeCM017610.1:107123131..107123370 +
CM017623.1chromosomeCM017623.1:59172866..59173104 -
CM017653.1chromosomeCM017653.1:21167742..21168016 +
CM017649.1chromosomeCM017649.1:59732801..59733039 +
CM017640.1chromosomeCM017640.1:23233333..23233610 +
CM017636.1chromosomeCM017636.1:114506569..114506808 +
CM017705.1chromosomeCM017705.1:20832744..20833018 +
CM017701.1chromosomeCM017701.1:57817069..57817307 +
CM017692.1chromosomeCM017692.1:22628090..22628367 +
CM017688.1chromosomeCM017688.1:104624034..104624276 +
Sequence
>NAU2741 ID=NAU2741|Name=NAU2741|organism=Gossypium raimondii|type=genetic_marker|length=169bp
AGTCCACGTCCACAGACTTTGCCCCCTTTACGCCGGAGAGGACCTTCTTG
ACCTTACGAGCACAACCTTCACAATCCATCCTGATTTTGAGAGCTACAGT
TTGAATTTGCTTCTTCTTCTTCTTCTTCTTCACGCTGAAGAGCAAATCAG
AGATGTATTCCAAGGTGCC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0170.02NAU2741b
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr19N/AAD_chr.19114.54NAU2741a
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr01N/AAD_chr.0120nau2741
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr19N/AAD_chr.19201nau2741
5Yumian-1 x T586, RIL (2006)YT-RIL_chr01-2N/AAD_chr.0176.2nau2741
6(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr01-2N/AAD_chr.0170.8nau2741
760182 x Jun Mian 1, F2:3 (2007)6J-F2:3_chr23N/AAD_chr.2336.6nau2741
8Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0168nau2741
9Prema x 86-1, RIL (2015)P8-RIL_chr01.3N/AAD_chr.0188.18nau2741
10DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.01102.74nau2741
11DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.15102.74nau2741
12DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.0125.4nau2741
13DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.1525.4nau2741
14CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.0193.8nau2741
15TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr01/A1N/AAD_chr.0183.37NAU2741-300
16TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr01N/AAD_chr.0180.6NAU2741-300
17TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr19N/AAD_chr.1996.8NAU2741-400
18TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr19/D5N/AAD_chr.1996.68NAU2741-400
19Yumian-1 x T586, RIL (2009)YT-RIL_chr01-2N/AAD_chr.0174.6NAU2741/220y(C1,C19)
20CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0154.03NAU2741
21PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr01N/AAt.0184.7NAU2741