NAU2725, NAU2725 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU2725
Genbank IDCO076743
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(ta)9
PCR ConditionAnnealing temperature: 57
Primer 1NAU2725_F: TGTATACCTCTCGTCCACCA
Primer 2NAU2725_R: GCATTGGAGAATCTCTCGTT
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO076743
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2725_FNAU2725_FGossypium raimondiiprimer
NAU2725_RNAU2725_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2725NAU2725Gossypium raimondiimarker_locus
NAU2725/900tNAU2725/900tGossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU2725 ID=NAU2725|Name=NAU2725|organism=Gossypium raimondii|type=genetic_marker|length=242bp
TGTATACCTCTCGTCCACCACTTGCCTCTTCCTTCCCAATTTATTGCCCA
TCAATAATATATATATATATATATAATTCGTGTTCCAAAAATTGTTCTCT
TCCCTTCTTCTCCTTTTACTTATTATTATTAGATTTACTCTTAAAATTCT
CCTTCGAATCCAGAAAATGGAGTCCGTGAATAGAAATTAGAGACTAAAAA
AAAAAGGAAAGATAGAGAGAATAACGAGAGATTCTCCAATGC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Yumian-1 x T586, RIL (2006)YT-RIL_chr01-1N/AAD_chr.010NAU2725
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0124NAU2725
3Yumian-1 x T586, RIL (2009)YT-RIL_chr01-1N/AAD_chr.0124.9NAU2725/900t