NAU2620, NAU2620 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU2620
Genbank IDCO072582
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(ct)9
PCR ConditionAnnealing temperature: 57
Primer 1NAU2620_F: GATCAACGCCACTGAGTACA
Primer 2NAU2620_R: ATGCAGCAATTAAACACGAA
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO072582
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2620_FNAU2620_FGossypium raimondiiprimer
NAU2620_RNAU2620_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2620NAU2620Gossypium raimondiimarker_locus
NAU2620-405NAU2620-405Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D07chromosomeD07:11756445..11756690 +
A07chromosomeA07:14524410..14524649 +
CM018221.1chromosomeCM018221.1:11191168..11191423 +
CM018208.1chromosomeCM018208.1:14476998..14477237 +
D5_07chromosomeD5_07:11268751..11268987 +
Chr1chromosomeChr1:51696987..51697242 +
tig00019444_CRI-A2_v1.0.a1chromosometig00019444_CRI-A2_v1.0.a1:122628..122883 +
Chr1chromosomeChr1:29014501..29014737 -
D10_07chromosomeD10_07:42915888..42916131 -
scaffold913.1supercontigscaffold913.1:275051..275290 -
Dt_chr1chromosomeDt_chr1:45931762..45932007 -
D07chromosomeD07:11229810..11230055 +
A07chromosomeA07:13768717..13768956 +
Ghir_D07chromosomeGhir_D07:11667465..11667710 +
Ghir_A07chromosomeGhir_A07:14786543..14786782 +
D07chromosomeD07:11155936..11156181 +
A07chromosomeA07:14170819..14171058 +
D07chromosomeD07:11632939..11633182 +
A07chromosomeA07:14779714..14779953 +
D07chromosomeD07:11521872..11522117 +
A07chromosomeA07:14731767..14732006 +
Dt07chromosomeDt07:12676084..12676337 +
At07chromosomeAt07:14927063..14927302 +
scaffold23657supercontigscaffold23657:46893..47146 +
scaffold1552supercontigscaffold1552:331703..331942 +
Gbar_D07chromosomeGbar_D07:11595638..11595893 +
Gbar_A07chromosomeGbar_A07:14464108..14464347 +
D07chromosomeD07:11315149..11315404 +
A07chromosomeA07:14570733..14570972 +
CM017616.1chromosomeCM017616.1:14421017..14421258 +
CM017655.1chromosomeCM017655.1:11812910..11813171 +
CM017642.1chromosomeCM017642.1:14459592..14459835 +
CM017707.1chromosomeCM017707.1:11520420..11520667 +
CM017694.1chromosomeCM017694.1:14710532..14710769 +
Chr01chromosomeNAU2620:1..674 .
Chr01:11166809..11168182 +
Chr1chromosomeNAU2620:1..674 .
Chr1:29013398..29014781 -
Sequence
>NAU2620 ID=NAU2620|Name=NAU2620|organism=Gossypium raimondii|type=genetic_marker|length=237bp
GATCAACGCCACTGAGTACAATTTGCAAACGCTCGGTAATGGCTACCGAC
ATAGATAAATGTAACAGAAAACATATATATGTACAAGTTTATGCCTCTCT
CTCTCTCTCTCTGTCTAGTTTTCAACTTCCACTCTTGCAGCTATCAGTTT
TTTTTCAGACAAGTTCTCCTTTGAGTGCAGCTGCGGCTCTTTGGATGGCT
CTAGCAACTCTCCAGATTTCGTGTTTAATTGCTGCAT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.1688NAU2620
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr16N/AAD_chr.1679.67NAU2620
3H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.1628.1NAU2620
40-153 x sGK9708, RIL (2016)0s-RIL_chr07-1N/AAD_chr.070NAU2620
5TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.1662.3NAU2620-405
6TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1660.89NAU2620-405
7H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1661NAU2620-405