NAU2489, NAU2489 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU2489
Genbank IDDT053298
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDT053298.1
Source TypeEST
Repeat MotifAT(10)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2489_F: AAGCTTAAAGCATCGAGGAC
Primer 2NAU2489_R: GAATGACACCATTTTCACCA
Product Length246
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
Xuzhou 142breeding_germplasm
Xuzhou 142breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT053298
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2489_FNAU2489_FGossypium hirsutumprimer
NAU2489_RNAU2489_RGossypium hirsutumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqUHML.CY-RIL_ch04.swu11Gossypium hirsutumQTL


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT053298.1DT053298.1Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2489aNAU2489aGossypium hirsutummarker_locus
NAU2489bNAU2489bGossypium hirsutummarker_locus
NAU2489NAU2489Gossypium hirsutummarker_locus
NAU2489NAU2489-84.026Gossypium hirsutummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU2489 ID=NAU2489|Name=NAU2489|organism=Gossypium hirsutum|type=genetic_marker|length=246bp
AAGCTTAAAGCATCGAGGACGAAGAGGCCATATATATATATATATATATG
CATGTTGATGATGATGTTATTATAAAAATAAACTTGTTTTGTTGCTGTAT
ATTTTCCTTTGGGTTTTTGTAGTTGGTAGTGTTGAATAATATTTCCCTTA
TATTTTCCCTCTCACCGCGTGTCCACCGCATGCACACATGTTTNAGTAGT
CTTTTGATCATGGGTGGTGGTGATGATGGTGAAAATGGTGTCATTC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr04N/AAD_chr.0457.4NAU2489aView
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr22N/AAD_chr.2267.6NAU2489bView
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr04N/AAD_chr.0437.7NAU2489View
4Yumian-1 x 7235, RIL (2015)Y7-RIL_chr22N/AAD_chr.2270.6NAU2489View
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr04N/AAt.0484.03NAU2489View