NAU2477, NAU2477 (genetic_marker) Gossypium hirsutum

Marker Overview


Name	NAU2477
Alias	NAU2477=NAU2162 NAU2162
Genbank ID	DT052869
Type	SSR
Species	Gossypium hirsutum
Germplasm	Xuzhou 142 Xuzhou 142
Source Sequence	DT052869.1
Source Type	EST
Repeat Motif	AT(10)
PCR Condition	Annealing temperature: 57
Primer 1	NAU2477_F: CACGAGTGTCCTTGCTACAG
Primer 2	NAU2477_R: ACACAAAAACCCAAAGGAAA
Product Length	212
Publication	[view all]
Contact	Zhang, Tian-Zhen
Comment	Primer data obtained in 2007-05

Contact

Name

Details

Zhang, Tian-Zhen

First name:	Tian-Zhen
Last name:	Zhang
Title:	Professor
Institution:	Zhejiang University
Address:	College of Agriculture and Biotechnology, Zhejiang University, Hangzhou , 310058 , Zhejiang , China
Country:	China
Email:	cotton@zju.edu.cn
Phone:	+86 571 88982971
Fax:	+86 571 88982971
Keywords:	cotton genetics and genomics, and breeding
Last update:	18-Mar-2022

Cross References

External references for this genetic_marker


Database	Accession
DB:genbank	DT052869

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
D04	chromosome	D04:52987797..52988006 +
CM018218.1	chromosome	CM018218.1:50888496..50888701 +
D5_04	chromosome	D5_04:3167157..3167360 -
KI_2_4	chromosome	KI_2_4:2782685..2782897 -
Chr04_CRI-A2_v1.0.a1	chromosome	Chr04_CRI-A2_v1.0.a1:3888291..3888496 -
D10_04	chromosome	D10_04:49195438..49195644 +
D04	chromosome	D04:47894246..47894455 +
Ghir_D04	chromosome	Ghir_D04:52748794..52749003 +
D04	chromosome	D04:53548540..53548749 +
D04	chromosome	D04:52605848..52606057 +
D04	chromosome	D04:50604223..50604432 +
Dt04	chromosome	Dt04:49266730..49266933 +
scaffold572	supercontig	scaffold572:116846..117049 +
Gbar_D04	chromosome	Gbar_D04:48945595..48945800 +
D04	chromosome	D04:54053676..54053881 +
CM017626.1	chromosome	CM017626.1:50998119..50998320 +
CM017652.1	chromosome	CM017652.1:53931951..53932156 +
CM017639.1	chromosome	CM017639.1:88727693..88727895 +
CM017704.1	chromosome	CM017704.1:51225513..51225716 +
D04	chromosome	D04:54519269..54519478 +
Chr04	chromosome	Chr04:107397660..107397867 +
Chr04	chromosome	Chr04:3124789..3124992 -
B_02	chromosome	B_02:3820741..3820941 -
Chr12	chromosome	Chr12:50875246..50875464 +
Chr12	chromosome	Chr12:50820054..50820257 +
Chr12	chromosome	Chr12:19606769..19606973 +
E04	chromosome	E04:101660217..101660431 +
F04	chromosome	F04:88119582..88119784 +
Chr04	chromosome	Chr04:173857242..173857440 +
Chr12	chromosome	NAU2477:14..550 . Chr12:32303687..32304313 +
Chr12	chromosome	NAU2477:14..550 . Chr12:1522585..1523218 -

Publications


Year	Publication
2006	Han Z, Wang C, Song X, Guo W, Gou J, Li C, Chen X, Zhang T. Characteristics, development and mapping of Gossypium hirsutum derived EST-SSRs in allotetraploid cotton. Theoretical and applied genetics. 2006; 112(3):430-439

Germplasm


Stock Name	Type
Xuzhou 142	accession
Xuzhou 142	accession

Relationships

The following sequence_feature feature(s) derives from this genetic_marker:


Feature Name	Unique Name	Species	Type
DT052869.1	DT052869.1	Gossypium hirsutum	sequence_feature

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Hai-7124 x Junmian-1, BC1 (2008) part	AD_ch22_Dt.04	N/A	47.3	NAU2477a	View
2	TM-1 x 3-79, RIL (2012)	AD_ch04_At.04	N/A	77.6	NAU2477a	View
3	Yumian-1 x T586, RIL (2015)	AD_ch04_At.04	N/A	60.2	NAU2477a	View
4	TM-1 x 3-79, RIL (2014)	AD_ch04_At.04	N/A	78.2	NAU2477a	View
5	AD-genome wide Reference Map (2009)	AD_ch04_At.04	N/A	30	nau2477	View
6	AD-genome wide Reference Map (2009)	AD_ch22_Dt.04	N/A	69	nau2477	View
7	Yumian-1 x T586, RIL (2006)	AD_ch04_At.04	N/A	23.1	nau2477	View
8	(YM1 x CCRI35) x (YM1 x 7235), 4WC (2012)	AD_ch22_Dt.04	N/A	30.2	nau2477	View
9	Yumian-1 x 7235, RIL (2015)	AD_ch22_Dt.04	N/A	67.2	nau2477	View
10	CCRI 12-4 x (AD)5-7, F2 (2015)	AD_ch22_Dt.04	N/A	30.1	nau2477	View
11	CCRI-35 x Yumian-1, RIL (2015)	AD_ch04_At.04	N/A	36	nau2477	View
12	TM-1 x 3-79, RIL (2012)	AD_ch22_Dt.04	N/A	48.41	NAU2477b	View
13	Yumian-1 x T586, RIL (2015)	AD_ch22_Dt.04	N/A	70.2	NAU2477b	View
14	TM-1 x 3-79, RIL (2014)	AD_ch22_Dt.04	N/A	81.9	NAU2477b	View
15	TM-1 x Hai-7124, BC1 (2007)	AD_ch04_At.04	N/A	84.3	NAU2477-200	View
16	TM-1 x Hai-7124, BC1 (2008)	AD_ch04_At.04	N/A	82.12	NAU2477-200	View
17	TM-1 x Hai-7124, BC1 (2012)	AD_ch04_At.04	N/A	43.4	NAU2477-200	View
18	TM-1 x Hai-7124, BC1 (2007)	AD_ch22_Dt.04	N/A	68.6	NAU2477-205	View
19	TM-1 x Hai-7124, BC1 (2008)	AD_ch22_Dt.04	N/A	68.98	NAU2477-205	View
20	TM-1 x Hai-7124, BC1 (2012)	AD_ch22_Dt.04	N/A	52.8	NAU2477-205	View
21	Yumian-1 x T586, RIL (2009)	AD_ch04_At.04	N/A	17.7	NAU2477/200t(C4,C22)	View
22	CCRI-35 x Yumian-1, RIL (2017)	AD_ch04_At.04	N/A	84.03	NAU2477	View
23	TM-1 x 3-79, RIL (2012.v3)	AD_ch04_At.04	N/A	78.16	NAU2477a	View
24	TM-1 x 3-79, RIL (2012.v3)	AD_ch22_Dt.04	N/A	81.94	NAU2477b	View
25	PD 94042 x (AD)4-08, F2 (2016)	AD_ch22_Dt.04	N/A	105.7	NAU2477	View

Sequence

>NAU2477 ID=NAU2477; Name=NAU2477; organism=Gossypium hirsutum; type=genetic_marker; length=212bp
CACGAGTGTCCTTGCTACAGAGATAAGGTGAACAACAAGGGCAAACCCAA
ATGCCCTTGAAAATGAAATATATTCGAGTTCGGGATTTAATCAAGCTTAA
AGATCGAGGACGAAGAGGCCATATATATATATATATATATGCATGTTGAT
GATGATGTTATTATAAAAATAAACTTGTTTTGTTGCTGTTATTTTCCTTT
GGGTTTTTGTGT

Search form

NAU2477, NAU2477 (genetic_marker) Gossypium hirsutum