NAU2437, NAU2437 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU2437
Genbank IDDT052111
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDT052111.1
Source TypeEST
Repeat MotifATAC(8)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2437_F: CTTGGAAAAAGGAAGAGCAG
Primer 2NAU2437_R: TTAAAAGACCAAAGGCAAGG
Product Length234
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
Xuzhou 142breeding_germplasm
Xuzhou 142breeding_germplasm
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2437_FNAU2437_FGossypium hirsutumprimer
NAU2437_RNAU2437_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed protein contentqSPC.YT-RIL_ch15.cq11Gossypium hirsutumQTL
seed oil contentqSOC.YT-RIL_ch15.cq11Gossypium hirsutumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber uniformityqFU.CY-RIL_ch01.swu11Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2437NAU2437Gossypium hirsutummarker_locus
NAU2437aNAU2437aGossypium hirsutummarker_locus
NAU2437bNAU2437bGossypium hirsutummarker_locus
NAU2437-270NAU2437-270Gossypium hirsutummarker_locus
NAU2437/220t(C15)NAU2437/220t(C15)Gossypium hirsutummarker_locus
NAU2437NAU2437-100.425Gossypium hirsutummarker_locus
NAU2437NAU2437-115.994Gossypium hirsutummarker_locus
NAU2437NAU2437-178.6Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT052111.1DT052111.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:64307103..64307344 +
A01chromosomeA01:103865020..103865253 +
CM018215.1chromosomeCM018215.1:62570737..62570990 +
CM018202.1chromosomeCM018202.1:112937710..112937947 +
D5_01chromosomeD5_01:56476045..56476294 +
KI_01chromosomeKI_01:38017864..38018077 +
Chr2chromosomeChr2:70415308..70415543 +
tig00000254_CRI-A2_v1.0.a1chromosometig00000254_CRI-A2_v1.0.a1:188249..188484 -
Chr2chromosomeChr2:165956..166205 -
CM016614.1chromosomeCM016614.1:137045314..137045547 +
scaffold2318.1supercontigscaffold2318.1:121967..122196 +
At_chr9chromosomeAt_chr9:42338832..42339073 +
scaffold2616.1supercontigscaffold2616.1:166718..166959 -
D01chromosomeD01:61423875..61424116 +
A01chromosomeA01:99877687..99877920 +
Ghir_D01chromosomeGhir_D01:63117219..63117460 +
Ghir_A01chromosomeGhir_A01:117611146..117611379 +
D01chromosomeD01:64532285..64532526 +
A01chromosomeA01:117977729..117977962 +
D01chromosomeD01:64528839..64529066 +
A01chromosomeA01:115897390..115897630 +
D01chromosomeD01:60994139..60994368 +
A01chromosomeA01:112484263..112484496 +
Dt01chromosomeDt01:62967857..62968082 +
scaffold18544supercontigscaffold18544:89272..89497 +
scaffold908supercontigscaffold908:69105..69662 -
Gbar_A01chromosomeGbar_A01:115462846..115463083 +
D01chromosomeD01:63455551..63455820 +
A01chromosomeA01:115444030..115444267 +
CM017623.1chromosomeCM017623.1:63833998..63834244 +
CM017610.1chromosomeCM017610.1:113982944..113983193 +
CM017649.1chromosomeCM017649.1:65541010..65541247 +
CM017636.1chromosomeCM017636.1:121635155..121635396 +
CM017701.1chromosomeCM017701.1:63319590..63319827 +
Sequence
>NAU2437 ID=NAU2437|Name=NAU2437|organism=Gossypium hirsutum|type=genetic_marker|length=234bp
CTTGGAAAAAGGAAGAGCAGAATTTTATACACCAACAGAATGAGAATGTT
GAGAAAGAAAAAAAGAATAAACCACTGACCACAAGACAATACATACATAC
ATACATACATACATACATACACACGTATATATATATTTGCTATTCACTAA
GATGGAGAATTTAACATATTGAATGAAATGAAAATTTTCAACAAGCATAT
CCAAAAGGATGTGTCCTTGCCTTTGGTCTTTTAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr15N/AAD_chr.1510NAU2437View
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr15N/AAD_chr.15160.41NAU2437View
3Yumian-1 x T586, RIL (2006)YT-RIL_chr15-1N/AAD_chr.1521.5NAU2437View
4Yumian-1 x T586, RIL (2015)YT-RIL.15_chr15N/AAD_chr.15115.8NAU2437View
5DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-2N/AAD_chr.150NAU2437View
6W10 x TM-1, F2:3 (2015)WT-F2:3_chr01-2N/AAD_chr.018.2NAU2437View
7GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.01196.9NAU2437View
80-153 x sGK9708, RIL (2016)0s-RIL_chr15-2N/AAD_chr.15108.9NAU2437View
9DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15-3N/AAD_chr.15-314.7NAU2437View
10CCRI-36 x G2005, RIL (2016)CG-RIL_chr01N/AAD_chr.01132.33NAU2437View
11TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c01N/AAD_chr.01144.38NAU2437aView
12TM-1 x 3-79, RIL (2014)T3-RIL.14_chr01N/AAD_chr.010NAU2437aView
13CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr15N/AAD_chr.15124.3NAU2437aView
14TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.01N/AAD_chr.010NAU2437aView
15TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c15N/AAD_chr.15118NAU2437bView
16TM-1 x 3-79, RIL (2014)T3-RIL.14_chr15N/AAD_chr.150NAU2437bView
17GX1135 x GX100-2, F2 (2013)GG-F2_chr01N/AAD_chr.01189.9NAU2437bView
18CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.0126.4NAU2437bView
19TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.15N/AAD_chr.150NAU2437bView
20TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr15N/AAD_chr.15118.5NAU2437-270View
21TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr15/D1N/AAD_chr.15116.63NAU2437-270View
22Yumian-1 x T586, RIL (2009)YT-RIL_chr15-3N/AAD_chr.150NAU2437/220t(C15)View
23CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.01100.43NAU2437-100.425View
24CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.01115.99NAU2437-115.994View
25MGG-293-793, MAGIC (2018)MAGIC-19831_chr15N/AAD_chr.15178.6NAU2437-178.6View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT052111