NAU2432, NAU2432 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU2432
Genbank IDDT051953
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDT051953.1
Source TypeEST
Repeat MotifAGA(8)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2432_F: AACTACAAAAGGATGAACATGG
Primer 2NAU2432_R: TAGGGTTATTGCAGGCTAGG
Product Length158
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
Xuzhou 142breeding_germplasm
Xuzhou 142breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT051953
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2432_FNAU2432_FGossypium hirsutumprimer
NAU2432_RNAU2432_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2432NAU2432Gossypium hirsutummarker_locus
NAU2432-460NAU2432-460Gossypium hirsutummarker_locus
NAU2432-170NAU2432-170Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT051953.1DT051953.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D07chromosomeD07:17583947..17584104 -
A07chromosomeA07:21986532..21986684 -
CM018221.1chromosomeCM018221.1:16916513..16916679 -
CM018208.1chromosomeCM018208.1:21973220..21973369 -
D5_07chromosomeD5_07:16010480..16010637 -
KI_07chromosomeKI_07:27706006..27706167 +
Chr1chromosomeChr1:70581716..70581869 -
tig00017252_CRI-A2_v1.0.a1chromosometig00017252_CRI-A2_v1.0.a1:815821..815974 +
Chr1chromosomeChr1:20423359..20423516 +
D10_07chromosomeD10_07:37680897..37681045 +
CM016620.1chromosomeCM016620.1:52295874..52296025 -
Dt_chr1chromosomeDt_chr1:50883838..50883995 +
Dt_chr1chromosomeDt_chr1:33743704..33743856 -
D07chromosomeD07:17017845..17018002 -
A07chromosomeA07:21067795..21067947 -
Ghir_D07chromosomeGhir_D07:17417471..17417628 -
Ghir_A07chromosomeGhir_A07:22337651..22337803 -
D07chromosomeD07:16698677..16698834 -
A07chromosomeA07:21358895..21359047 -
D07chromosomeD07:17388671..17388828 -
A07chromosomeA07:22385825..22385977 -
D07chromosomeD07:16941385..16941542 -
A07chromosomeA07:22125031..22125183 -
scaffold20462supercontigscaffold20462:325787..325953 +
scaffold10932supercontigscaffold10932:65919..66394 +
scaffold10685supercontigscaffold10685:4933..5082 +
Gbar_D07chromosomeGbar_D07:17358201..17358367 -
Gbar_A07chromosomeGbar_A07:21922136..21922285 -
D07chromosomeD07:16971056..16971222 -
A07chromosomeA07:21942970..21943119 -
CM017629.1chromosomeCM017629.1:17352593..17352747 -
CM017616.1chromosomeCM017616.1:21862067..21862216 -
CM017655.1chromosomeCM017655.1:17595614..17595771 -
CM017642.1chromosomeCM017642.1:21982534..21982683 -
CM017707.1chromosomeCM017707.1:17283853..17284007 -
CM017694.1chromosomeCM017694.1:22275440..22275589 -
Chr01chromosomeNAU2432:1..547 .
Chr01:16508344..16508890 -
Chr1chromosomeNAU2432:1..547 .
Chr1:20423351..20423897 +
Sequence
>NAU2432 ID=NAU2432|Name=NAU2432|organism=Gossypium hirsutum|type=genetic_marker|length=158bp
AACTACAAAAGGATGAACATGGTTATGATTTTATTCCATGGAAAAGAGAA
GAAGAAGAAGAAGAAGAAGACAAGGTTGAAAATAAAACATTAAAACAAGC
AAAAGCTCAAAAACCTAACACTGGAAAACAAGAAGCTTCCTAGCCTGCAA
TAACCCTA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr07N/AAD_chr.0747.31NAU2432
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c16N/AAD_chr.1670.62NAU2432
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c07N/AAD_chr.0755.84NAU2432
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch16N/AAD_chr.1628.93NAU2432
5Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch07N/AAD_chr.0729.95NAU2432
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr16N/AAD_chr.1672NAU2432
7AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr07N/AAD_chr.07181NAU2432
8H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.1641.2NAU2432
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr16N/ADt.0782.6NAU2432
10TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr07N/AAD_chr.0724.1NAU2432-460
11TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr07/A7N/AAD_chr.0795.46NAU2432-460
12TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr16N/AAD_chr.1671.5NAU2432-170
13TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1670.53NAU2432-170
14H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1671.3NAU2432-170
Image
File NameLegend
46_FISH_GEN-178-1117_fig3.jpgTwo BAC translocations involving two chromosome pairs of At2 and A3 and At4 and A5 between G. arboreum and A-subgenome of G. hirsutum. [Image from Wang et al., 2008, GEN-178-1117]