NAU2300, NAU2300 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU2300
Genbank IDDT049190
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDT049190.1
Source TypeEST
Repeat MotifACAAC(4)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2300_F: TCATGTCATGGGAAACAGAG
Primer 2NAU2300_R: GCTGTCGAAGTGAAGGAAGT
Product Length238
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
Xuzhou 142breeding_germplasm
Xuzhou 142breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT049190
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2300_FNAU2300_FGossypium hirsutumprimer
NAU2300_RNAU2300_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
nau2300nau2300Gossypium hirsutummarker_locus
NAU2300-500NAU2300-500Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT049190.1DT049190.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017622.1chromosomeCM017622.1:103901869..103902099 -
CM017648.1chromosomeCM017648.1:108843447..108843678 -
Sequence
>NAU2300 ID=NAU2300|Name=NAU2300|organism=Gossypium hirsutum|type=genetic_marker|length=238bp
TCATGTCATGGGAAACAGAGCATTTTTTTTTCACTTACAAAGGCATTTGG
TTGCACTACCATTCCAGTTGATTGAAGCAACAACACAACACAACACAACA
CATTTCTCGGAAACTATGTAGTACCATAAAATAAAATCACTTTTTTCTAT
TGATTGCTAATAATGATATTCTAGTACATTAAGGCTTTCTTCTGTTGGGA
ATTGAAAAAGGACTCTAGACTTCCTTCACTTCGACAGC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.1355nau2300
2H18 x TM-1, F2 (2005)H18TM1-F2_chr13N/AAD_chr.13144.5nau2300
3CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr13N/AAt.1356.5nau2300
4TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr13/A13N/AAD_chr.1339.47NAU2300-500
5TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr13N/AAD_chr.1339.1NAU2300-500