NAU2218, NAU2218 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU2218
Genbank IDDT048008
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDT048008.1
Source TypeEST
Repeat MotifAT(7)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2218_F: CTCATTCTTCACAACTTCCAAC
Primer 2NAU2218_R: TAAATTCTGGGGAGACGAAG
Product Length124
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
Xuzhou 142breeding_germplasm
Xuzhou 142breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT048008
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2218_FNAU2218_FGossypium hirsutumprimer
NAU2218_RNAU2218_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT048008.1DT048008.1Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2218NAU2218Gossypium hirsutummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU2218 ID=NAU2218|Name=NAU2218|organism=Gossypium hirsutum|type=genetic_marker|length=124bp
CTCATTCTTCACAACTTCCAACTACATTAGTATATTTATAATTGATAACC
ATATATATATATATTAACTAAGTATATTATTTTTAACAAAAACATCTGGT
TTGGCTTCGTCTCCCCAGAATTTA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1GX1135 x GX100-2, F2 (2013)GG-F2_chr01N/AAD_chr.010NAU2218
2GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.0177NAU2218