NAU2151, NAU2151 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU2151
Genbank IDDT046817
TypeSSR
SpeciesGossypium hirsutum
GermplasmXuzhou 142
Xuzhou 142
Source SequenceDT046817.1
Source TypeEST
Repeat MotifTCA(4)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2151_F: GACAACGATCCCAAATAAGC
Primer 2NAU2151_R: TCGTCGTCATCTTCTTCTGA
Product Length220
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
Xuzhou 142breeding_germplasm
Xuzhou 142breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT046817
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2151_FNAU2151_FGossypium hirsutumprimer
NAU2151_RNAU2151_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT046817.1DT046817.1Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2151NAU2151Gossypium hirsutummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D11chromosomeD11:71498879..71499098 +
A11chromosomeA11:112495979..112496197 +
CM018225.1chromosomeCM018225.1:67848483..67848700 +
CM018212.1chromosomeCM018212.1:112850750..112850969 +
D5_11chromosomeD5_11:1700686..1700897 -
Chr4chromosomeChr4:80115720..80115940 -
Chr11_CRI-A2_v1.0.a1chromosomeChr11_CRI-A2_v1.0.a1:2177861..2178081 -
Chr8chromosomeChr8:6630042..6630253 -
D10_11chromosomeD10_11:66077979..66078200 +
CM016624.1chromosomeCM016624.1:142441321..142441538 +
scaffold56.1supercontigscaffold56.1:2595137..2595356 +
scaffold58364supercontigscaffold58364:148..366 +
D11chromosomeD11:64224924..64225143 +
A11chromosomeA11:91434518..91434736 +
Ghir_D11chromosomeGhir_D11:71129153..71129372 +
Ghir_A11chromosomeGhir_A11:121300783..121301001 +
D11chromosomeD11:69634725..69634944 +
A11chromosomeA11:119604386..119604604 +
D11chromosomeD11:70717297..70717516 +
A11chromosomeA11:117475042..117475260 +
D11chromosomeD11:67431425..67431644 +
A11chromosomeA11:113952740..113952958 +
Dt11chromosomeDt11:64562947..64563164 +
At11chromosomeAt11:95510206..95510424 +
At11chromosomeAt11:95511305..95511524 +
scaffold2954supercontigscaffold2954:207786..208004 +
scaffold2954supercontigscaffold2954:208885..209104 +
scaffold15997supercontigscaffold15997:91238..91455 +
Gbar_D11chromosomeGbar_D11:67711186..67711403 +
Gbar_A11chromosomeGbar_A11:111193445..111193664 +
D11chromosomeD11:70576875..70577092 +
A11chromosomeA11:114357382..114357601 +
CM017633.1chromosomeCM017633.1:69125989..69126208 +
CM017620.1chromosomeCM017620.1:118593798..118594018 +
CM017659.1chromosomeCM017659.1:71740420..71740636 +
CM017646.1chromosomeCM017646.1:124898925..124899144 +
CM017711.1chromosomeCM017711.1:67277862..67278079 +
CM017698.1chromosomeCM017698.1:113181003..113181221 +
Chr07chromosomeNAU2151:2..538 .
Chr07:59338775..59339303 +
Chr8chromosomeNAU2151:4..538 .
Chr8:6629790..6630316 -
Sequence
>NAU2151 ID=NAU2151|Name=NAU2151|organism=Gossypium hirsutum|type=genetic_marker|length=220bp
GACAACGATCCCAAATAAGCCAACGACTTCATCATCATCATCGAAAACGT
AAAATTAAAAACCCATAAAATTTCAACAACTACAAGCGTTAAAAAAAAAA
AAGAACCCGTCTTTTTATTCGAACTACACATTGAAATCAAAAGCGTTCGC
AGAGATCCGTACCCCAGATCCCGGTCGAAATTTGCTTCAAAACATCTCAG
TCAGAAGAAGATGACGACGA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x TX-41, F2 (2020)CT-F2_chr21N/AAD_chr.21146.2NAU2151View