NAU2092, NAU2092 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU2092
Genbank IDDR044179
TypeSSR
SpeciesGossypium hirsutum
Germplasm7235
7235
Source SequenceDR044179.1
Source TypeEST
Repeat MotifGAC(8); GAC(5)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2092_F: GGATGATGAAGGCGAAGAT
Primer 2NAU2092_R: CTTCATCGTCATCACTGTCA
Product Length225
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
7235breeding_germplasm
7235breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDR044179
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2092_FNAU2092_FGossypium hirsutumprimer
NAU2092_RNAU2092_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DR044179.1DR044179.1Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2092NAU2092Gossypium hirsutummarker_locus
NAU2092/190tNAU2092/190tGossypium hirsutummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A01chromosomeA01:3485868..3486079 +
A01chromosomeA01:3184631..3184854 +
CM018215.1chromosomeCM018215.1:2303289..2303506 +
CM018202.1chromosomeCM018202.1:2507563..2507774 +
D5_01chromosomeD5_01:2334893..2335104 +
Chr7chromosomeChr7:107772335..107772546 +
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:2475888..2476099 +
Chr8chromosomeChr8:61997368..61997579 -
D10_01chromosomeD10_01:58264067..58264278 -
CM016614.1chromosomeCM016614.1:3431858..3432066 +
scaffold1463.1supercontigscaffold1463.1:72615..72838 -
scaffold3710_D01supercontigscaffold3710_D01:110095..110318 +
A01chromosomeA01:2245875..2246086 +
Ghir_D01chromosomeGhir_D01:2493702..2493925 +
Ghir_A01chromosomeGhir_A01:2781052..2781263 +
D01chromosomeD01:2371587..2371810 +
A01chromosomeA01:2674879..2675090 +
D01chromosomeD01:2488429..2488652 +
A01chromosomeA01:2800738..2800949 +
D01chromosomeD01:2291136..2291338 +
A01chromosomeA01:2752701..2752912 +
scaffold7906supercontigscaffold7906:604315..604532 +
scaffold12265supercontigscaffold12265:278057..278268 -
Gbar_A01chromosomeGbar_A01:2497066..2497277 +
D01chromosomeD01:2432257..2432474 +
A01chromosomeA01:2497629..2497840 +
CM017623.1chromosomeCM017623.1:2546006..2546208 +
CM017610.1chromosomeCM017610.1:3016577..3016788 +
CM017649.1chromosomeCM017649.1:2357220..2357422 +
CM017636.1chromosomeCM017636.1:2542738..2542961 +
CM017701.1chromosomeCM017701.1:2681836..2682053 +
CM017688.1chromosomeCM017688.1:2524337..2524536 +
Sequence
>NAU2092 ID=NAU2092|Name=NAU2092|organism=Gossypium hirsutum|type=genetic_marker|length=225bp
GGATGATGAAGGCGAAGATGACGACGACGACGACGACGACGACNACAAGA
GAGGAGGATGACGATGTGCAGGTTCTTCACTCATCCGGTCCTCCTGTCCT
GATAGCTGATGACGACNAGGGCGANGATGTTAAAGACGATGATGACGACG
ATGAAGGCGAAGGCGACGGCGACGGCGATGTCGATGACGACGACGACGAC
GATGATGACAGTGATGACGATGAAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Yumian-1 x T586, RIL (2006)YT-RIL_chr01-1N/AAD_chr.0117.6NAU2092
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0111.5NAU2092
3Prema x 86-1, RIL (2015)P8-RIL_chr01.1N/AAD_chr.010NAU2092
4Yumian-1 x T586, RIL (2009)YT-RIL_chr01-1N/AAD_chr.017.3NAU2092/190t