NAU2084, NAU2084 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU2084
Genbank IDDR044172
TypeSSR
SpeciesGossypium hirsutum
Germplasm7235
7235
Source SequenceDR044172.1
Source TypeEST
Repeat MotifGAC(5)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2084_F: GCGAGGATGTTAAAGACGAT
Primer 2NAU2084_R: CCGGACAAGGTATTCTGTTC
Product Length150
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
7235breeding_germplasm
7235breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDR044172
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2084_FNAU2084_FGossypium hirsutumprimer
NAU2084_RNAU2084_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.0s-RIL_ch15-1.qz08Gossypium hirsutumQTL
fiber elongationqFEL.0s-RIL_ch15-1.qz09Gossypium hirsutumQTL


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DR044172.1DR044172.1Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2084NAU2084Gossypium hirsutummarker_locus
NAU2084/1000yNAU2084/1000yGossypium hirsutummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU2084 ID=NAU2084|Name=NAU2084|organism=Gossypium hirsutum|type=genetic_marker|length=150bp
GCGAGGATGTTAAAGACGATGATGACGACGATGAAGGCGAAGGCGACGGC
GACGGCGATGACGATGACGACGACGACGACNGATGATGACAGTGATGACG
ATGAAGAAGGTGAAGAAGAGGAGGATATGGGAACAGAATACCTTGTCCGG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Yumian-1 x T586, RIL (2006)YT-RIL_chr01-1N/AAD_chr.0113.2NAU2084
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0112.2NAU2084
3W10 x TM-1, F2:3 (2015)WT-F2:3_chr08N/AAD_chr.0893.8NAU2084
40-153 x sGK9708, RIL (2016)0s-RIL_chr15-1N/AAD_chr.1529.7NAU2084
5Yumian-1 x T586, RIL (2009)YT-RIL_chr01-1N/AAD_chr.0111.7NAU2084/1000y