NAU2083, NAU2083 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU2083
Genbank IDDR044172
TypeSSR
SpeciesGossypium hirsutum
Germplasm7235
7235
Source SequenceDR044172.1
Source TypeEST
Repeat MotifGAC(9)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2083_F: AGAAGAGGTTGACGGTGAAG
Primer 2NAU2083_R: TGAGTGAAGAACCTGCACAT
Product Length168
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
7235breeding_germplasm
7235breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDR044172
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2083_FNAU2083_FGossypium hirsutumprimer
NAU2083_RNAU2083_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2083NAU2083Gossypium hirsutummarker_locus
NAU2083-300NAU2083-300Gossypium hirsutummarker_locus
NAU2083/150y(C1)NAU2083/150y(C1)Gossypium hirsutummarker_locus
NAU2083NAU2083-144.377Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DR044172.1DR044172.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A01chromosomeA01:3485784..3485943 +
A01chromosomeA01:3184553..3184712 +
CM018215.1chromosomeCM018215.1:2303211..2303370 +
CM018202.1chromosomeCM018202.1:2507479..2507641 +
D5_01chromosomeD5_01:2334809..2334974 +
Chr7chromosomeChr7:107772251..107772413 +
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:2475804..2475966 +
Chr8chromosomeChr8:61997498..61997663 -
D10_01chromosomeD10_01:58264197..58264362 -
CM016614.1chromosomeCM016614.1:3431774..3431936 +
scaffold1463.1supercontigscaffold1463.1:72757..72916 -
scaffold3710_D01supercontigscaffold3710_D01:110017..110176 +
A01chromosomeA01:2245791..2245950 +
scaffold204763supercontigscaffold204763:33..192 -
Ghir_D01chromosomeGhir_D01:2493624..2493783 +
Ghir_A01chromosomeGhir_A01:2780968..2781127 +
D01chromosomeD01:2371509..2371668 +
A01chromosomeA01:2674795..2674954 +
D01chromosomeD01:2488351..2488510 +
A01chromosomeA01:2800654..2800813 +
D01chromosomeD01:2291049..2291208 +
A01chromosomeA01:2752617..2752776 +
scaffold7906supercontigscaffold7906:604237..604396 +
scaffold12265supercontigscaffold12265:278190..278352 -
Gbar_D01chromosomeGbar_D01:2534680..2534839 +
Gbar_A01chromosomeGbar_A01:2496982..2497144 +
D01chromosomeD01:2432179..2432338 +
A01chromosomeA01:2497545..2497707 +
CM017623.1chromosomeCM017623.1:2545919..2546078 +
CM017610.1chromosomeCM017610.1:3016493..3016652 +
CM017649.1chromosomeCM017649.1:2357133..2357292 +
CM017636.1chromosomeCM017636.1:2542654..2542822 +
CM017701.1chromosomeCM017701.1:2681758..2681917 +
CM017688.1chromosomeCM017688.1:2524253..2524403 +
Sequence
>NAU2083 ID=NAU2083|Name=NAU2083|organism=Gossypium hirsutum|type=genetic_marker|length=168bp
AGAAGAGGTTGACGGTGAAGATGAAAGTGAAGTAGAAGGTGGCGAACCGG
AAGAGGAAGACGACGATGACGACGACGAGGATGAGGATGATGAAGGCGAA
GATGACGACGACGACGACGACGACGACGACAAGGAGAGGAGGATGACGAT
GTGCAGGTTCTTCACTCA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c01N/AAD_chr.01113.98NAU2083
2Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch01N/AAD_chr.0197.91NAU2083
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr01N/AAD_chr.01181NAU2083
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c01N/AAD_chr.010NAU2083
5Yumian-1 x T586, RIL (2006)YT-RIL_chr01-1N/AAD_chr.0115NAU2083
6Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0110.9NAU2083
7Prema x 86-1, RIL (2015)P8-RIL_chr01.1N/AAD_chr.010NAU2083
8TM-1 x 3-79, RIL (2014)T3-RIL.14_chr01N/AAD_chr.01144.4NAU2083
9W10 x TM-1, F2:3 (2015)WT-F2:3_chr08N/AAD_chr.0896.3NAU2083
10(86-1 x G. anomalum) x Su8289, BC2F1 (2015)8S-BC2F1_chr01N/AB_chr.01111.5NAU2083
11CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr01N/AAt.01136NAU2083
12CCRI-36 x G2005, RIL (2016)CG-RIL_chr15N/AAD_chr.152.6NAU2083
13TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr01N/AAD_chr.0126.4NAU2083-300
14TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr01/A1N/AAD_chr.0129.74NAU2083-300
15Yumian-1 x T586, RIL (2009)YT-RIL_chr01-1N/AAD_chr.019.9NAU2083/150y(C1)
16TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.01N/AAD_chr.01144.38NAU2083