NAU1248, NAU1248 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1248
Genbank IDBF273634
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(TCTTCC)3
PCR ConditionAnnealing temperature: 57
Primer 1NAU1248_F: AATGTCAGCTGCCTATTTCC
Primer 2NAU1248_R: AAGACAGGCGATGTCATCTT
Product Length241
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBF273634
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1248_FNAU1248_FGossypium arboreumprimer
NAU1248_RNAU1248_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1248aNAU1248aGossypium arboreummarker_locus
NAU1248bNAU1248bGossypium arboreummarker_locus
nau1248nau1248Gossypium arboreummarker_locus
NAU1248-250NAU1248-250Gossypium arboreummarker_locus
NAU1248NAU1248-70.611Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU1248 ID=NAU1248|Name=NAU1248|organism=Gossypium arboreum|type=genetic_marker|length=241bp
AATGTCAGCTGCCTATTTCCCTCATCTTCCTCTTCCTCTTCCTCCATTTT
GGTTCCTTTTCTAACCGGCATTTCTTACCTTTTTTAACAAGGGAAAACAG
AAACCCTTACTTTAACCCAGAACATCAAGCGGCGCCGGCAGCTCAACTTT
GAAGAAGAACATTCTCATTTTGGCGACATCCTNGCTTTTGCTCTTTATTT
TCTTGCTCTCTTTCGCCATCGAAGATGACATCGCCTGTCTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr03N/AAD_chr.0323.9NAU1248aView
2CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr03N/AAD_chr.0325NAU1248bView
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr03N/AAD_chr.03107nau1248View
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c03N/AAD_chr.0345.76nau1248View
5HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr03-2N/AAD_chr.0346.5nau1248View
6TM-1 x 3-79, RIL (2014)T3-RIL.14_chr03N/AAD_chr.0370.6nau1248View
7CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr03N/AAt.0383.9nau1248View
8TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr03N/AAD_chr.0361.2NAU1248-250View
9TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr03/A3N/AAD_chr.0359.29NAU1248-250View
10TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.03N/AAD_chr.0370.61NAU1248View
Image
File NameLegend
45_FISH_GEN-178-1117_fig2.jpgBAC clones and their corresponding genetic markers of the 22 probes according to FISH signal patterns in Figure 1. [Image from Wang et al., 2008, GEN-178-1117]
48_FISH_TAG-115-675.jpgTwenty-six individual cotton mitotic chromosomes with FISH signals derived from the chromosome-speciWc BACs, and comparisons of linkage and FISH maps. [Image from Wang 2007, TAG-115-675]