NAU1225, NAU1225 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1225
Genbank IDBG440640
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(GCTCAT)3
PCR ConditionAnnealing temperature: 57
Primer 1NAU1225_F: CAGCAAATTCGCAAGAGTTA
Primer 2NAU1225_R: CTAACAGGGGTGACATAGGG
Product Length241
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBG440640
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1225_FNAU1225_FGossypium arboreumprimer
NAU1225_RNAU1225_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1225NAU1225Gossypium arboreummarker_locus
NAU1225-bNAU1225-bGossypium arboreummarker_locus
NAU1225-aNAU1225-aGossypium arboreummarker_locus
NAU1225/250yNAU1225/250yGossypium arboreummarker_locus
NAU1225NAU1225-99.402Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU1225 ID=NAU1225|Name=NAU1225|organism=Gossypium arboreum|type=genetic_marker|length=241bp
CAGCAAATTCGCAAGAGTTAACACCATTGATATAGAGACAACTTCCAGAG
AGCAAAAGCACGAGACCTTCGTTCCCCAGACCACCCAAAAGCCACATGAA
CAAGAGCCAAGGTTCATGCCTGAAACCCAAAATGGTTATGGCCTTGTCGG
CCACGAGTCAGGCTCATGCTCATGCTCATGCTCATGCCGGCCCAGCTTCA
CGCACCGAAGAGACCTATGAACCCTATGTCACCCCTGTTAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A05-3N/AAD_chr.050.6NAU1225
2Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch19/D05N/AAD_chr.190.2NAU1225
3Yumian-1 x T586, RIL (2006)YT-RIL_chr05-2N/AAD_chr.050NAU1225
460182 x Jun Mian 1, F2:3 (2007)6J-F2:3_chr23N/AAD_chr.230NAU1225
5Yumian-1 x T586, RIL (2015)YT-RIL.15_chr05N/AAD_chr.0549.4NAU1225
6PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr19/LGD08-1N/AAD_chr.190.8NAU1225
7Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.0511.3NAU1225
80-153 x sGK9708, RIL (2016)0s-RIL_chr19-1N/AAD_chr.1917.4NAU1225
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr05N/AAt.0590.8NAU1225
10CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr19N/ADt.05124.9NAU1225
11CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr05N/AAD_chr.0557.6NAU1225
12Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A13N/AA_chr.138.5NAU1225-b
13Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A13N/AA_chr.1359.8NAU1225-a
14Yumian-1 x T586, RIL (2009)YT-RIL_chr05N/AAD_chr.050NAU1225/250y
15CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.0599.4NAU1225