NAU1221, NAU1221 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1221
Genbank IDBG440896
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(TCAAGC)5
PCR ConditionAnnealing temperature: 57
Primer 1NAU1221_F: CATGCAAATCCATGCTAGAG
Primer 2NAU1221_R: AGGTTTCTTTGGTGGTGAAA
Product Length242
Restriction EnzymeEcoRI; XhoI
PolymorphismP_ NAU1221
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBG440896
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1221_FNAU1221_FGossypium arboreumprimer
NAU1221_RNAU1221_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqFL.9s-F2.ch19.ay12Gossypium hirsutumQTL
lint percentqLP.9s-F2.ch19.ay12Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1221NAU1221Gossypium arboreummarker_locus
NAU1221aNAU1221aGossypium arboreummarker_locus
NAU1221cNAU1221cGossypium arboreummarker_locus
NAU1221bNAU1221bGossypium arboreummarker_locus
NAU1221-310NAU1221-310Gossypium arboreummarker_locus
NAU1221/220y(C19)NAU1221/220y(C19)Gossypium arboreummarker_locus
NAU1221_232/238NAU1221_232/238Gossypium arboreummarker_locus
NAU1221NAU1221-98.833Gossypium arboreummarker_locus
NAU1221cNAU1221c-138.232Gossypium arboreummarker_locus
NAU1221aNAU1221a-148.68Gossypium arboreummarker_locus
NAU1221bNAU1221b-120.956Gossypium arboreummarker_locus
NAU1221NAU1221-101.9Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU1221 ID=NAU1221|Name=NAU1221|organism=Gossypium arboreum|type=genetic_marker|length=242bp
CATGCAAATCCATGCTAGAGAGTACTTCAGCAAATTCCCAAGAGTTAACA
CCAATGAGAAAGAGACAACAACCAGAGAGNCAAAGCACGAGACCTTCGTT
CCCCAGACCCACCCAAAGCCAGAAGAAACAGAGCCAAGGTTCATTCCTTG
AAACCCAAATGGTTATGGCCTTTACGGCCAAGAGTCAAGCTCAAGCTCAA
GCTCAAGCTCAAGCCGGGCCAATTTCACCACCAAAGAAACCT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_D08N/AAD_chr.19128NAU1221View
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr19N/AAD_chr.19157NAU1221View
3Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch19/D05N/AAD_chr.190NAU1221View
4Yumian-1 x T586, RIL (2006)YT-RIL_chr05-2N/AAD_chr.055.5NAU1221View
5PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr19/LGD08-1N/AAD_chr.190.9NAU1221View
6Yumian-1 x T586, RIL (2015)YT-RIL.15_chr05N/AAD_chr.0556.1NAU1221View
7Baimian 1 x TM-1 , F2:3 (2014)BT-F2:3_chr19-2N/AAD_chr.1934.2NAU1221View
8Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.0515NAU1221View
9TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr19-1N/AAD_chr.1917.9NAU1221View
100-153 x sGK9708, RIL (2016)0s-RIL_chr19-1N/AAD_chr.1915.2NAU1221View
11(86-1 x G. anomalum) x Su8289, BC2F1 (2015)8S-BC2F1_chr05N/AB_chr.05102.5NAU1221View
12CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr05N/AAt.0585.9NAU1221View
13CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr05N/AAD_chr.0554.3NAU1221View
14TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c05N/AAD_chr.0552.04NAU1221aView
15(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr05-2N/AAD_chr.0570.2NAU1221aView
16TM-1 x 3-79, RIL (2014)T3-RIL.14_chr05N/AAD_chr.05148.7NAU1221aView
17GX1135 x GX100-2, F2 (2013)GG-F2_chr19-2N/AAD_chr.1945.7NAU1221aView
18901-001 x sGK156, F2 (2019)Chr19N/AAD_chr.1912.73NAU1221aView
19TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c05N/AAD_chr.0558.27NAU1221cView
20TM-1 x 3-79, RIL (2014)T3-RIL.14_chr05N/AAD_chr.05138.2NAU1221cView
21TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c19N/AAD_chr.1962.86NAU1221bView
22(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr21-3N/AAD_chr.21127.3NAU1221bView
23TM-1 x 3-79, RIL (2014)T3-RIL.14_chr19N/AAD_chr.19121NAU1221bView
24GX1135 x GX100-2, F2 (2013)GG-F2_chr19-2N/AAD_chr.1943.1NAU1221bView
25901-001 x sGK156, F2 (2019)Chr19N/AAD_chr.1920.5NAU1221bView
26TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr19N/AAD_chr.1969.9NAU1221-310View
27TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr19/D5N/AAD_chr.1969.64NAU1221-310View
28Yumian-1 x T586, RIL (2009)YT-RIL_chr05N/AAD_chr.055.5NAU1221/220y(C19)View
29TM-1 x 3-79, RIL (2011)T3-RIL.11_chr19N/AAD_chr.1926.9NAU1221_232/238View
30CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.0598.83NAU1221View
31TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.05N/AAD_chr.05138.23NAU1221cView
32TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.05N/AAD_chr.05148.68NAU1221aView
33TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.19N/AAD_chr.19120.96NAU1221bView
34PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr05N/AAt.05101.9NAU1221View