NAU1215, NAU1215 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1215
Genbank IDBG441590
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(AAC)6
PCR ConditionAnnealing temperature: 57
Primer 1NAU1215_F: GAGTGAGACTGGAGCTGGTT
Primer 2NAU1215_R: CAAATCATTGTTTGCAGCAG
Product Length184
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBG441590
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1215_FNAU1215_FGossypium arboreumprimer
NAU1215_RNAU1215_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1215NAU1215Gossypium arboreummarker_locus
NAU1215-300NAU1215-300Gossypium arboreummarker_locus
NAU1215NAU1215-150.7Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D13chromosomeD13:55569529..55569714 +
A13chromosomeA13:94525045..94525228 +
CM018227.1chromosomeCM018227.1:51358282..51358461 +
CM018214.1chromosomeCM018214.1:98421279..98421459 +
D5_13chromosomeD5_13:51294706..51294884 -
KI_13chromosomeKI_13:37125119..37125299 +
Chr13chromosomeChr13:117716446..117716629 -
Chr13_CRI-A2_v1.0.a1chromosomeChr13_CRI-A2_v1.0.a1:113251456..113251639 +
Chr7chromosomeChr7:9093303..9093482 +
D10_13chromosomeD10_13:52439350..52439527 +
CM016626.1chromosomeCM016626.1:145364869..145365049 +
At_chr13chromosomeAt_chr13:20513951..20514134 +
At_chr8chromosomeAt_chr8:76826806..76826991 -
D13chromosomeD13:51431310..51431495 +
A13chromosomeA13:70850699..70850954 +
Ghir_D13chromosomeGhir_D13:54496750..54496935 +
Ghir_A13chromosomeGhir_A13:98274791..98274974 +
D13chromosomeD13:55535975..55536160 +
A13chromosomeA13:100768235..100768418 +
D13chromosomeD13:54662724..54662909 +
A13chromosomeA13:98831416..98831599 +
D13chromosomeD13:51337836..51338021 +
A13chromosomeA13:97210448..97210631 +
At13chromosomeAt13:76825868..76826048 +
scaffold7164supercontigscaffold7164:252978..253158 +
scaffold1393supercontigscaffold1393:427333..427512 +
Gbar_D13chromosomeGbar_D13:51071884..51072063 +
Gbar_A13chromosomeGbar_A13:99368858..99369038 +
D13chromosomeD13:52363539..52363718 +
A13chromosomeA13:102779954..102780134 +
CM017635.1chromosomeCM017635.1:52145511..52145690 +
CM017622.1chromosomeCM017622.1:100369599..100369779 +
CM017661.1chromosomeCM017661.1:55375882..55376061 +
CM017648.1chromosomeCM017648.1:105546036..105546219 -
CM017713.1chromosomeCM017713.1:52029091..52029270 +
CM017700.1chromosomeCM017700.1:100661025..100661205 +
Sequence
>NAU1215 ID=NAU1215|Name=NAU1215|organism=Gossypium arboreum|type=genetic_marker|length=184bp
GAGTGAGACTGGAGCTGGTTCAAGTAATCTTAAGCTAAACCAAACCTCCT
CTTCCTATGCTTCAAGCACCGAGAATATATCTCGTCTCCTTCAAGGTTGG
ATGAGATCGTCACCCAAGATTAACAACAACAACAACAACAGCGACAGCAT
TGGGAGTTGTTCAGCTGCTGCAAACAATGATTTG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr13/lgA01N/AAD_chr.1379.6NAU1215
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c13N/AAD_chr.1344.18NAU1215
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c18N/AAD_chr.1849.45NAU1215
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch18N/AAD_chr.1836.73NAU1215
5Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A13N/AA_chr.1351.6NAU1215
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.13165NAU1215
7H18 x TM-1, F2 (2005)H18TM1-F2_chr13N/AAD_chr.13130.4NAU1215
8TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr13N/AAD_chr.1383.6NAU1215-300
9TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr13/A13N/AAD_chr.1325.45NAU1215-300
10PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr18N/ADt.13150.7NAU1215