NAU1201, NAU1201 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1201
Genbank IDBG442619
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(TCCATC)3
PCR ConditionAnnealing temperature: 57
Primer 1NAU1201_F: CCGATATCTTACTTTCCAACCT
Primer 2NAU1201_R: AAGGGGTTTGAAGGGTTATC
Product Length165
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBG442619
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1201_FNAU1201_FGossypium arboreumprimer
NAU1201_RNAU1201_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1201NAU1201Gossypium arboreummarker_locus
NAU1201-155NAU1201-155Gossypium arboreummarker_locus
NAU1201/180t(C13)NAU1201/180t(C13)Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D13chromosomeD13:39367592..39367762 +
A13chromosomeA13:72562305..72562475 +
CM018227.1chromosomeCM018227.1:35689594..35689752 +
CM018214.1chromosomeCM018214.1:77806824..77806982 +
D5_13chromosomeD5_13:34974113..34974271 +
Chr13chromosomeChr13:133855647..133855811 +
Chr13_CRI-A2_v1.0.a1chromosomeChr13_CRI-A2_v1.0.a1:89104547..89104711 +
scaffold234supercontigscaffold234:385250..385408 +
D10_13chromosomeD10_13:36951540..36951704 +
CM016626.1chromosomeCM016626.1:113141457..113141621 +
Dt_chr9chromosomeDt_chr9:18844940..18845110 +
Dt_chr13chromosomeDt_chr13:26615475..26615645 +
At_chr12chromosomeAt_chr12:78981219..78981389 +
D13chromosomeD13:35330866..35331036 +
A13chromosomeA13:49726182..49726352 +
Ghir_D13chromosomeGhir_D13:38765029..38765199 +
Ghir_A13chromosomeGhir_A13:76854211..76854381 +
D13chromosomeD13:40120469..40120639 +
A13chromosomeA13:79900586..79900756 +
D13chromosomeD13:38902986..38903156 +
A13chromosomeA13:77795892..77796062 +
D13chromosomeD13:35831851..35832021 +
A13chromosomeA13:76478865..76479035 +
At13chromosomeAt13:53478234..53478392 +
At13chromosomeAt13:53473854..53474012 +
scaffold1834supercontigscaffold1834:16487..16645 +
scaffold1834supercontigscaffold1834:12107..12265 +
scaffold26288supercontigscaffold26288:250..408 -
Gbar_D13chromosomeGbar_D13:35440164..35440322 +
Gbar_A13chromosomeGbar_A13:78928010..78928168 +
D13chromosomeD13:36992635..36992793 +
A13chromosomeA13:82141630..82141788 +
CM017622.1chromosomeCM017622.1:79546102..79546278 +
CM017661.1chromosomeCM017661.1:39484020..39484178 +
CM017648.1chromosomeCM017648.1:83167382..83167552 +
CM017713.1chromosomeCM017713.1:36769821..36769979 +
CM017700.1chromosomeCM017700.1:80102093..80102257 +
Sequence
>NAU1201 ID=NAU1201|Name=NAU1201|organism=Gossypium arboreum|type=genetic_marker|length=165bp
CCGATATCTTACTTTCCAACCTCTTTCTTCCATCTCCATCTCCATCTCCT
TTCTGCAATTATTCCCAACTTTCCATGGCTTCCTTCACACCCAATCTAGA
ACCTGCCCCTGACACCTCTCTTCAGTTCAAGCCCAAGAAACCCAGGATAA
CCCTTCAAACCCCTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_A01N/AAD_chr.1383.8NAU1201
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.13123NAU1201
3Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr13N/AAD_chr.130NAU1201
4Yumian-1 x T586, RIL (2006)YT-RIL_chr13-2N/AAD_chr.1315.6NAU1201
5H18 x TM-1, F2 (2005)H18TM1-F2_chr13N/AAD_chr.1398.1NAU1201
6Yumian-1 x T586, RIL (2015)YT-RIL.15_chr13N/AAD_chr.1363.3NAU1201
7TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr13N/AAD_chr.1360.4NAU1201
8CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr13N/AAt.1386.3NAU1201
9TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr13N/AAD_chr.1358.6NAU1201-155
10TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr13/A13N/AAD_chr.1358.95NAU1201-155
11Yumian-1 x T586, RIL (2009)YT-RIL_chr13-2N/AAD_chr.133.7NAU1201/180t(C13)