NAU1200, NAU1200 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1200
Genbank IDBG442686
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(CAG)11
PCR ConditionAnnealing temperature: 57
Primer 1NAU1200_F: CAACAGCAACAACCACAA
Primer 2NAU1200_R: CTGCCTCGAGGACAAATAGT
Product Length213
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBG442686
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1200_FNAU1200_FGossypium arboreumprimer
NAU1200_RNAU1200_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqFL.7T-ch5.e1Gossypium hirsutumQTL
lint percentqLP.9s-F2.ch05.hi13Gossypium hirsutumQTL
micronaireqMIC.9s-F2.ch05.hi13Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1200NAU1200Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A05chromosomeA05:54620940..54621176 +
D05chromosomeD05:47891784..47891990 -
CM018206.1chromosomeCM018206.1:62575526..62575732 +
CM018219.1chromosomeCM018219.1:47306554..47306760 -
D5_05chromosomeD5_05:43419259..43419459 -
Chr10chromosomeChr10:92857381..92857593 +
Chr05_CRI-A2_v1.0.a1chromosomeChr05_CRI-A2_v1.0.a1:76832130..76832342 +
scaffold222supercontigscaffold222:160757..160957 -
D10_05chromosomeD10_05:15339037..15339237 +
CM016618.1chromosomeCM016618.1:26262396..26262602 +
At_chr3chromosomeAt_chr3:1227849..1228073 +
Dt_chr9chromosomeDt_chr9:22332155..22332361 -
A05chromosomeA05:49494584..49494820 +
D05chromosomeD05:46703596..46703802 -
Ghir_D05chromosomeGhir_D05:47663124..47663330 -
Ghir_A05chromosomeGhir_A05:67092260..67092496 -
A05chromosomeA05:68697865..68698101 +
D05chromosomeD05:48748364..48748570 -
A05chromosomeA05:67478079..67478303 +
D05chromosomeD05:49424826..49425032 -
A05chromosomeA05:66447782..66448018 +
D05chromosomeD05:48178695..48178901 -
At05chromosomeAt05:48940467..48940673 +
Dt05chromosomeDt05:49846120..49846326 -
scaffold5512supercontigscaffold5512:215591..215797 +
scaffold9167supercontigscaffold9167:208326..208532 -
Gbar_D05chromosomeGbar_D05:44952638..44952844 +
Gbar_A05chromosomeGbar_A05:63090840..63091046 +
A05chromosomeA05:65595930..65596136 +
D05chromosomeD05:49614898..49615104 -
CM017614.1chromosomeCM017614.1:64553923..64554129 +
CM017627.1chromosomeCM017627.1:48554786..48554992 -
CM017640.1chromosomeCM017640.1:68435863..68436060 +
CM017653.1chromosomeCM017653.1:49682936..49683148 -
CM017692.1chromosomeCM017692.1:64651296..64651502 +
CM017705.1chromosomeCM017705.1:48844605..48844811 -
scaffold222supercontigNAU1200:1..653 .
scaffold222:160317..160957 -
Chr09chromosomeNAU1200:1..653 .
Chr09:43771056..43771696 -
Sequence
>NAU1200 ID=NAU1200|Name=NAU1200|organism=Gossypium arboreum|type=genetic_marker|length=213bp
CAACAGCAACAACCACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
GTTCTTGCATGCTGCTGGTGCACCGCATTACATTCATCATCACCAGTCTG
GGGCAGTGCCAATCTCAGCTTATTATCCTGTATATCCTTCCCAACAGCAA
CATCACCATCATCAAACACAGATTGATCAGCAATATCCCCTGTACTATTT
GTCCTCGAGGCAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A05N/AAD_chr.0516.6NAU1200
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.0536NAU1200
3Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch05/A05-2N/AAD_chr.0595.3NAU1200
4(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr05-2N/AAD_chr.0573.1NAU1200
57235 x TM-1, F2:3 (2005)7T-F2:3_chr05N/AAD_chr.050NAU1200
6Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.0593.6NAU1200
7TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr05-1N/AAD_chr.0546.6NAU1200
80-153 x sGK9708, RIL (2016)0s-RIL_chr05-2N/AAD_chr.0598.1NAU1200
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr05N/AAt.05181.3NAU1200
10901-001 x sGK156, F2 (2019)Chr05N/AAD_chr.054.82NAU1200