NAU1190, NAU1190 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1190
Genbank IDBG443893
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(GGC)6
PCR ConditionAnnealing temperature: 57
Primer 1NAU1190_F: CCATGTCCGTATCCATGTTA
Primer 2NAU1190_R: TAAGGCAAGATAGGGTCAGG
Product Length239
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBG443893
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1190_FNAU1190_FGossypium arboreumprimer
NAU1190_RNAU1190_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
lint percentqLP.7T-ch3.e2Gossypium hirsutumQTL
lint percentqLP.7T-ch3.e3Gossypium hirsutumQTL
lint percentqLP.7T-ch3.e4Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1190NAU1190Gossypium arboreummarker_locus
NAU1190-400NAU1190-400Gossypium arboreummarker_locus
NAU1190/200y(C3)NAU1190/200y(C3)Gossypium arboreummarker_locus
NAU1190aNAU1190aGossypium arboreummarker_locus
NAU1190_205NAU1190_205Gossypium arboreummarker_locus
NAU1190bNAU1190bGossypium arboreummarker_locus
NAU1190cNAU1190cGossypium arboreummarker_locus
NAU1190NAU1190-58.17Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D02chromosomeD02:53190181..53190398 -
A03chromosomeA03:82264515..82264729 -
CM018216.1chromosomeCM018216.1:49890940..49891157 -
CM018204.1chromosomeCM018204.1:83555495..83555727 -
D5_03chromosomeD5_03:17412676..17412893 +
KI_03chromosomeKI_03:33828353..33828573 -
Chr13chromosomeChr13:119886221..119886459 -
Chr03_CRI-A2_v1.0.a1chromosomeChr03_CRI-A2_v1.0.a1:107864452..107864690 -
scaffold203supercontigscaffold203:598911..599128 -
D10_03chromosomeD10_03:17232447..17232664 +
CM016616.1chromosomeCM016616.1:28827339..28827556 -
Dt_chr5chromosomeDt_chr5:34478135..34478352 +
At_chr5chromosomeAt_chr5:26306992..26307206 -
D02chromosomeD02:50485507..50485724 -
A03chromosomeA03:75568551..75568765 -
Ghir_D02chromosomeGhir_D02:52287611..52287828 -
Ghir_A03chromosomeGhir_A03:89358101..89358315 -
D02chromosomeD02:52918554..52918771 -
A03chromosomeA03:88602416..88602630 -
D02chromosomeD02:53665296..53665513 -
A03chromosomeA03:86384991..86385205 -
D02chromosomeD02:50709622..50709839 -
A03chromosomeA03:81951326..81951540 -
At03chromosomeAt03:77602573..77602805 -
scaffold10038supercontigscaffold10038:931323..931540 +
scaffold10038supercontigscaffold10038:929304..929521 +
scaffold1128supercontigscaffold1128:417423..417655 -
Gbar_D02chromosomeGbar_D02:50469564..50469781 -
Gbar_A03chromosomeGbar_A03:82910951..82911183 -
D02chromosomeD02:51816271..51816488 -
A03chromosomeA03:85032082..85032317 -
CM017624.1chromosomeCM017624.1:52700954..52701171 -
CM017612.1chromosomeCM017612.1:84532453..84532694 -
CM017638.1chromosomeCM017638.1:90859732..90859973 -
CM017702.1chromosomeCM017702.1:51299115..51299332 -
CM017690.1chromosomeCM017690.1:84966533..84966768 -
Sequence
>NAU1190 ID=NAU1190|Name=NAU1190|organism=Gossypium arboreum|type=genetic_marker|length=239bp
CCATGTCCGTATCCATGTTACCCACCACCAACAGGCAGCGGCGGCGGAGG
CGAAGGTGGAGGCGGCGGCGGCGGCGGCACAGTGACACAAACACCTCCAG
CTAGTTACTCACCACCCTCCCAAACAGGATCAGTATACCCTCCACCTACA
GGGAACTTACCATATTACTATCCACCACCACCTTATGGTGGAGGTAATTC
TTTATATGGTCAGCCCCCTCCTGACCCTATCTTGCCTTA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A03N/AAD_chr.0319.1NAU1190
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr03N/AAD_chr.03101NAU1190
3TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.03N/AAD_chr.0366.8NAU1190
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c03N/AAD_chr.0358.2NAU1190
5Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr03N/AAD_chr.0327.6NAU1190
6Yumian-1 x T586, RIL (2006)YT-RIL_chr03-2N/AAD_chr.0341.9NAU1190
77235 x TM-1, F2:3 (2005)7T-F2:3_chr03N/AAD_chr.0332.6NAU1190
8Yumian-1 x T586, RIL (2015)YT-RIL.15_chr03N/AAD_chr.0362NAU1190
9TM-1 x 3-79, RIL (2014)T3-RIL.14_chr03N/AAD_chr.0358.2NAU1190
100-153 x sGK9708, RIL (2016)0s-RIL_chr15-2N/AAD_chr.1525.5NAU1190
11(86-1 x G. anomalum) x Su8289, BC2F1 (2015)8S-BC2F1_chr02N/AB_chr.0283.8NAU1190
12CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr15N/ADt.0175.2NAU1190
13CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr03N/AAt.0393.3NAU1190
14CCRI-36 x G2005, RIL (2016)CG-RIL_chr03N/AAD_chr.0366.64NAU1190
15TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr03N/AAD_chr.0362.9NAU1190-400
16TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr03/A3N/AAD_chr.0360.37NAU1190-400
17Yumian-1 x T586, RIL (2009)YT-RIL_chr03-2N/AAD_chr.0343.1NAU1190/200y(C3)
18DH962 x Jinmian-6, F2 (2009)DJ-F2_chr03N/AAD_chr.0346.3NAU1190a
19DH962 x Jinmian-6, F2 (2009)DJ-F2_chr03/LG23N/AAD_chr.0346.3NAU1190a
20HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr03-1N/AAD_chr.030NAU1190a
21DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr07-1N/AAD_chr.0784.01NAU1190a
22TM-1 x Hai-7124, BC1S1 (2007)TH-BC1S1_chr05N/AAD_chr.0580.7NAU1190_205
23HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr03-1N/AAD_chr.030NAU1190b
24HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr03-1N/AAD_chr.032.1NAU1190c
25TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.03N/AAD_chr.0358.17NAU1190