NAU1167, NAU1167 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1167
AliasNAU1167=NAU3995
NAU3995
Genbank IDBG445815
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(GATAGG)4
PCR ConditionAnnealing temperature: 57
Primer 1NAU1167_F: CTGACTTGGACCGAGAACTT
Primer 2NAU1167_R: AAGAGCCCTGGACAATGATA
Product Length207
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBG445815
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1167_FNAU1167_FGossypium arboreumprimer
NAU1167_RNAU1167_RGossypium arboreumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqSL2.5.TTT-CSIL_ch03.p2-df14Gossypium hirsutumQTL
fiber lengthqSL2.5.TTT-CSIL_ch03.p2-nj13Gossypium hirsutumQTL
fiber lengthqSL2.5.TTT-CSIL_ch03.p2-sy15Gossypium hirsutumQTL
micronaireqMIC.Y7-RIL_ch17.bb09Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1167NAU1167Gossypium arboreummarker_locus
NAU1167-aNAU1167-aGossypium arboreummarker_locus
NAU1167-bNAU1167-bGossypium arboreummarker_locus
NAU1167-200NAU1167-200Gossypium arboreummarker_locus
NAU1167aNAU1167aGossypium arboreummarker_locus
NAU1167bNAU1167bGossypium arboreummarker_locus
NAU1167NAU1167-82Gossypium arboreummarker_locus
NAU1167NAU1167-87.472Gossypium arboreummarker_locus
NAU1167NAU1167-18.914Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A03chromosomeA03:3444998..3445204 +
D03chromosomeD03:49012108..49012296 -
CM018204.1chromosomeCM018204.1:3573691..3573891 +
CM018217.1chromosomeCM018217.1:49291155..49291343 -
D5_02chromosomeD5_02:42854117..42854323 -
KI_2_4chromosomeKI_2_4:38411183..38411383 -
Chr7chromosomeChr7:77430883..77431089 +
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:110170014..110170220 +
Chr3chromosomeChr3:2570465..2570671 +
D10_02chromosomeD10_02:47231208..47231414 -
CM016615.1chromosomeCM016615.1:107946970..107947158 -
At_chr5chromosomeAt_chr5:2164279..2164485 +
scaffold154.1supercontigscaffold154.1:1567188..1567376 -
A03chromosomeA03:2643780..2643986 +
D03chromosomeD03:42842863..42843051 -
Ghir_A03chromosomeGhir_A03:4391385..4391585 +
Ghir_D03chromosomeGhir_D03:48818033..48818221 -
A03chromosomeA03:3941065..3941271 +
D03chromosomeD03:50128947..50129135 -
A03chromosomeA03:4212030..4212236 +
D03chromosomeD03:49797244..49797432 -
A03chromosomeA03:3633226..3633426 +
D03chromosomeD03:49074472..49074666 -
scaffold16974supercontigscaffold16974:12993..13181 +
scaffold23090supercontigscaffold23090:47124..47324 -
Gbar_A03chromosomeGbar_A03:3601896..3602096 +
Gbar_D03chromosomeGbar_D03:47687508..47687696 -
A03chromosomeA03:3677512..3677712 +
D03chromosomeD03:50079460..50079648 -
CM017612.1chromosomeCM017612.1:3903898..3904098 +
CM017625.1chromosomeCM017625.1:48504996..48505190 -
CM017638.1chromosomeCM017638.1:4275629..4275835 +
CM017651.1chromosomeCM017651.1:52687188..52687382 -
CM017690.1chromosomeCM017690.1:3865176..3865376 +
CM017703.1chromosomeCM017703.1:50158559..50158753 -
Sequence
>NAU1167 ID=NAU1167|Name=NAU1167|organism=Gossypium arboreum|type=genetic_marker|length=207bp
CTGACTTGGACCGAGAACTTGAATCCATCATTAGGAATAGAAGAAGGAAC
TCTGCATCGATCGTGCAGCTGCTTCAAGGTGTTAGAGAGAGAATGGTATC
TGAAGGCGAGAATTCTGAGAATGATAGGGATAGGGATAGGGATAGGGACA
GGGACGGAGTAATTNTCATCAATCCTTTCAATCAGACTATCATTGTCCAG
GGCTCTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr17N/AAD_chr.1725NAU1167
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr17N/AAD_chr.1729NAU1167
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr03N/AAD_chr.0311NAU1167
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c03N/AAD_chr.0397.46NAU1167
5Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_lg06N/AAD_unknown0NAU1167
6(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr17-3N/AAD_chr.1739.1NAU1167
7Prema x 86-1, RIL (2015)P8-RIL_chr03.3N/AAD_chr.0354.7NAU1167
8Baimian 1 x TM-1 , F2:3 (2014)BT-F2:3_chr03N/AAD_chr.0357NAU1167
9Yumian-1 x 7235, RIL (2015)Y7-RIL_chr17N/AAD_chr.1784.9NAU1167
10DH962 X Ji Mian 5, F2 (2015)DJiM-F2_LG42N/AAD_chr.unknown4.18NAU1167
11TM-1 x 3-79, RIL (2014)T3-RIL.14_chr03N/AAD_chr.0318.9NAU1167
12W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.02200.1NAU1167
13(86-1 x G. anomalum) x Su8289, BC2F1 (2015)8S-BC2F1_chr03N/AB_chr.0335.2NAU1167
14DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_LG5N/Aunknown0NAU1167
15CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr17N/ADt.0330.2NAU1167
16CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr17N/AAD_chr.1767.9NAU1167
17LMY28 x XLZ24, RIL (2018)LX-RIL_chr03N/AAD_chr.0385.26NAU1167
18Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A02N/AA_chr.028.8NAU1167-a
19Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A03N/AA_chr.03167.2NAU1167-b
20TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr03/A3N/AAD_chr.03105.33NAU1167-200
21TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr03N/AAD_chr.03107.5NAU1167-200
22TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr03N/AAD_chr.0386.8NAU1167a
23TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr17N/AAD_chr.1791.2NAU1167b
24CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr17N/ADt.0382NAU1167
25CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr17N/ADt.0387.47NAU1167
26TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.03N/AAD_chr.0318.91NAU1167