NAU1159, NAU1159 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1159
Genbank IDBG446213
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(ATACAT)3
PCR ConditionAnnealing temperature: 57
Primer 1NAU1159_F: ATTTTGGCAGACCTTCATTC
Primer 2NAU1159_R: CTATGACCCGTTTTGGTTTT
Product Length223
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1159_FNAU1159_FGossypium arboreumprimer
NAU1159_RNAU1159_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1159NAU1159Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU1159 ID=NAU1159|Name=NAU1159|organism=Gossypium arboreum|type=genetic_marker|length=223bp
ATTTTGGCAGACCTTCATTCTGCAAATTTAATGCTTCTTACCAAAGAAGG
CCCCCCAAGGGCCAAAATATAATACATATACATATACATATATTTATATA
TTACATGAAAAAAGGAAGGATTATATTTACTGTTATTGAGTACATTGAAC
AAAACATTACAAGTTCTTCCATAAGGATTTTCTCAAGAAGTCATAACTCG
AGGAAAACCAAAACGGGTCATAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_D02-2N/AN/A34.5NAU1159View
2W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.0253.6NAU1159View
3CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr02N/AAt.0225.1NAU1159View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBG446213