NAU1155, NAU1155 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1155
Genbank IDBG446521
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(GAC)6
PCR ConditionAnnealing temperature: 57
Primer 1NAU1155_F: AAGGGAAAAAGAATGTCGTG
Primer 2NAU1155_R: TTTTGGTAAGCTCGGATAGG
Product Length211
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBG446521
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1155_FNAU1155_FGossypium arboreumprimer
NAU1155_RNAU1155_RGossypium arboreumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed indexqSI.CY-RIL.17_ch02.ay14Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1155NAU1155Gossypium arboreummarker_locus
NAU1155/200tNAU1155/200tGossypium arboreummarker_locus
NAU1155aNAU1155aGossypium arboreummarker_locus
NAU1155bNAU1155bGossypium arboreummarker_locus
NAU1155NAU1155-83.602Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D03chromosomeD03:3180327..3180534 +
A02chromosomeA02:86984790..86985000 -
CM018217.1chromosomeCM018217.1:2918808..2919015 +
CM018203.1chromosomeCM018203.1:96612442..96612652 -
D5_02chromosomeD5_02:2904142..2904349 +
KI_06chromosomeKI_06:42739758..42739970 +
Chr3chromosomeChr3:36610067..36610277 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:2893865..2894075 +
Chr7chromosomeChr7:49037889..49038096 +
D10_02chromosomeD10_02:2864612..2864819 +
CM016615.1chromosomeCM016615.1:4166269..4166482 +
scaffold712.1supercontigscaffold712.1:665585..665792 +
scaffold3246.1supercontigscaffold3246.1:8469..8679 +
D03chromosomeD03:2943932..2944139 +
scaffold21468supercontigscaffold21468:36..246 -
A02chromosomeA02:80354140..80354350 -
Ghir_D03chromosomeGhir_D03:3033923..3034130 +
Ghir_A02chromosomeGhir_A02:104788300..104788510 -
D03chromosomeD03:2976471..2976678 +
A02chromosomeA02:105046740..105046950 -
D03chromosomeD03:3042148..3042355 +
A02chromosomeA02:102424196..102424406 -
D03chromosomeD03:3038215..3038422 +
A02chromosomeA02:101042198..101042408 -
At02chromosomeAt02:85724728..85724938 -
scaffold4125supercontigscaffold4125:862..1069 -
scaffold2476supercontigscaffold2476:98440..98650 -
Gbar_D03chromosomeGbar_D03:2926916..2927123 +
Gbar_A02chromosomeGbar_A02:96779790..96780000 -
D03chromosomeD03:2965795..2966002 +
A02chromosomeA02:98803319..98803529 -
CM017625.1chromosomeCM017625.1:2955625..2955832 +
CM017611.1chromosomeCM017611.1:101663205..101663415 -
CM017651.1chromosomeCM017651.1:3060616..3060829 +
CM017637.1chromosomeCM017637.1:106489843..106490053 -
CM017703.1chromosomeCM017703.1:2943162..2943369 +
CM017689.1chromosomeCM017689.1:98978260..98978470 -
Sequence
>NAU1155 ID=NAU1155|Name=NAU1155|organism=Gossypium arboreum|type=genetic_marker|length=211bp
AAGGGAAAAAGAATGTCGTGGTTAGCTAGATCGATTGCTAACTCGCTCAA
GCTTGACGACGACGACGACGACGATCGGACCAATGCGGCGCTGGATCCGA
AACCCGAATCCGATCCGAATCCTAACCAAGCCTCTCCTTCTCATTCCCAT
TCATCATCGGATCCCAACACTCCACGTGGCGTCAAAGAAGACCTATCCGA
GCTTACCAAAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Yumian-1 x T586, RIL (2006)YT-RIL_chr02-2N/AAD_chr.0244.4NAU1155
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr02N/AAD_chr.02106.8NAU1155
30-153 x sGK9708, RIL (2016)0s-RIL_chr02-1N/AAD_chr.022.8NAU1155
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.0234.5NAU1155
50-153 x sGK9708, RIL (2017)0s-RIL.17_chr02N/AAD_chr.0213.92NAU1155
6Yumian-1 x T586, RIL (2009)YT-RIL_chr02-1N/AAD_chr.0248.8NAU1155/200t
7HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr02N/AAD_chr.0246.9NAU1155a
8HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr02N/AAD_chr.0251.9NAU1155b
9CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.0283.6NAU1155