NAU1070, NAU1070 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1070
AliasNAU1070=NAU1071
NAU1071
Genbank IDBQ402529
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(AGG)10
PCR ConditionAnnealing temperature: 57
Primer 1NAU1070_F: CCCTCCATAACCAAAAGTTG
Primer 2NAU1070_R: ACCAACAATGGTGACCTCTT
Product Length173
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ402529
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1070_FNAU1070_FGossypium arboreumprimer
NAU1070_RNAU1070_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
verticillium wilt disease severityqVWDS.0s-RIL.17_c03.ay09.1Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1070NAU1070Gossypium arboreummarker_locus
NAU1070bNAU1070bGossypium arboreummarker_locus
NAU1070aNAU1070aGossypium arboreummarker_locus
NAU1070-400NAU1070-400Gossypium arboreummarker_locus
NAU1070-165NAU1070-165Gossypium arboreummarker_locus
NAU1070NAU1070-67.482Gossypium arboreummarker_locus
NAU1070bNAU1070b-80.903Gossypium arboreummarker_locus
NAU1070aNAU1070a-81.83Gossypium arboreummarker_locus
NAU1070NAU1070-75.8Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D02chromosomeD02:65574032..65574194 -
A03chromosomeA03:101992286..101992443 -
CM018216.1chromosomeCM018216.1:61694141..61694302 -
CM018204.1chromosomeCM018204.1:99933065..99933243 -
D5_03chromosomeD5_03:5210245..5210411 +
Chr5chromosomeChr5:9747207..9747379 -
Chr03_CRI-A2_v1.0.a1chromosomeChr03_CRI-A2_v1.0.a1:129122390..129122562 -
Chr5chromosomeChr5:38609502..38609668 +
D10_03chromosomeD10_03:5097782..5097943 +
CM016616.1chromosomeCM016616.1:7335431..7335594 +
At_chr5chromosomeAt_chr5:50989480..50989642 +
At_chr5chromosomeAt_chr5:50006815..50006972 -
D02chromosomeD02:62604553..62604715 -
A03chromosomeA03:94274973..94275130 -
Ghir_D02chromosomeGhir_D02:64372944..64373106 -
Ghir_A03chromosomeGhir_A03:106637739..106637896 -
D02chromosomeD02:64534384..64534546 -
A03chromosomeA03:105548619..105548776 -
D02chromosomeD02:65745826..65745988 -
A03chromosomeA03:103704047..103704204 -
D02chromosomeD02:62861840..62862002 -
A03chromosomeA03:98961217..98961374 -
Dt02chromosomeDt02:64924784..64924945 -
Dt02chromosomeDt02:64933041..64933202 -
At03chromosomeAt03:96047235..96047413 -
scaffold4190supercontigscaffold4190:85931..86109 -
scaffold15736supercontigscaffold15736:120499..120660 -
scaffold15736supercontigscaffold15736:128756..128917 -
Gbar_D02chromosomeGbar_D02:62292061..62292222 -
Gbar_A03chromosomeGbar_A03:99094059..99094236 -
D02chromosomeD02:63598496..63598657 -
A03chromosomeA03:101450414..101450592 -
CM017624.1chromosomeCM017624.1:64648916..64649078 -
CM017612.1chromosomeCM017612.1:100716176..100716348 -
CM017650.1chromosomeCM017650.1:66254405..66254566 -
CM017638.1chromosomeCM017638.1:107894984..107895147 -
CM017702.1chromosomeCM017702.1:63186068..63186229 -
CM017690.1chromosomeCM017690.1:101880965..101881143 -
Sequence
>NAU1070 ID=NAU1070|Name=NAU1070|organism=Gossypium arboreum|type=genetic_marker|length=173bp
CCCTCCATAACCAAAAGTTGCATAAGAGAAAAAAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAAAATTTTAGAGTCAGAGAAAAAGAAAAGGTGTTTT
AAGCGTTGTTGAAAGGTGGGTTTCCATGTCAAAGTTACAGTGGCTTGTTT
CAGAAGAGGTCACCATTGTTGGT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A03N/AAD_chr.0335NAU1070
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr14N/AAD_chr.14212NAU1070
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr03N/AAD_chr.03156NAU1070
4(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr03-1N/AAD_chr.0314.3NAU1070
57235 x TM-1, F2:3 (2005)7T-F2:3_chr03N/AAD_chr.0366.5NAU1070
6HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr03-1N/AAD_chr.0342NAU1070
7TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr03N/AAD_chr.03103.2NAU1070
80-153 x sGK9708, RIL (2016)0s-RIL_chr03-2N/AAD_chr.0365.2NAU1070
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr03N/AAt.0374.1NAU1070
10CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr03N/AAD_chr.0358.3NAU1070
110-153 x sGK9708, RIL (2017)0s-RIL.17_chr03N/AAD_chr.030NAU1070
12TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c03N/AAD_chr.0335.47NAU1070b
13TM-1 x 3-79, RIL (2014)T3-RIL.14_chr03N/AAD_chr.0380.9NAU1070b
14TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c14N/AAD_chr.1444.59NAU1070a
15TM-1 x 3-79, RIL (2014)T3-RIL.14_chr14N/AAD_chr.1481.8NAU1070a
16TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr03N/AAD_chr.0351.9NAU1070-400
17TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr03/A3N/AAD_chr.0350.11NAU1070-400
18TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr14N/AAD_chr.1411.4NAU1070-165
19TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr14/D2N/AAD_chr.1412.78NAU1070-165
20CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr03N/AAt.0367.48NAU1070
21TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.03N/AAD_chr.0380.9NAU1070b
22TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.14N/AAD_chr.1481.83NAU1070a
23PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr03N/AAt.0375.8NAU1070