NAU1043, NAU1043 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1043
Genbank IDBQ404189
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(TTC)14
PCR ConditionAnnealing temperature: 57
Primer 1NAU1043_F: GTATCCGCCCACAAATAAAG
Primer 2NAU1043_R: GCATCGTGAGAGAAAGTGAA
Product Length238
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ404189
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1043_FNAU1043_FGossypium arboreumprimer
NAU1043_RNAU1043_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1043NAU1043Gossypium arboreummarker_locus
NAU1043aNAU1043aGossypium arboreummarker_locus
NAU1043dNAU1043dGossypium arboreummarker_locus
NAU1043cNAU1043cGossypium arboreummarker_locus
NAU1043eNAU1043eGossypium arboreummarker_locus
NAU1043bNAU1043bGossypium arboreummarker_locus
NAU1043-650NAU1043-650Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D07chromosomeD07:5219379..5219615 +
A07chromosomeA07:5207246..5207471 +
CM018221.1chromosomeCM018221.1:4907198..4907437 +
CM018208.1chromosomeCM018208.1:5499050..5499266 +
D5_07chromosomeD5_07:4819640..4819858 +
Chr1chromosomeChr1:66707758..66707995 +
Chr07_CRI-A2_v1.0.a1chromosomeChr07_CRI-A2_v1.0.a1:5536887..5537124 +
scaffold141supercontigscaffold141:356888..357106 -
D10_07chromosomeD10_07:48960455..48960679 -
CM016620.1chromosomeCM016620.1:108941450..108941689 -
Dt_chr7chromosomeDt_chr7:25085387..25085612 +
Dt_chr1chromosomeDt_chr1:41015811..41016047 -
D07chromosomeD07:4689187..4689423 +
A07chromosomeA07:4686920..4687145 +
Ghir_D07chromosomeGhir_D07:5154892..5155128 +
Ghir_A07chromosomeGhir_A07:5574496..5574721 +
D07chromosomeD07:4961260..4961496 +
A07chromosomeA07:5229561..5229786 +
D07chromosomeD07:5108405..5108641 +
A07chromosomeA07:5533143..5533368 +
D07chromosomeD07:4941702..4941937 +
A07chromosomeA07:5588450..5588672 +
Dt07chromosomeDt07:5345650..5345889 +
Dt07chromosomeDt07:5356009..5356223 +
scaffold13041supercontigscaffold13041:120784..121023 +
scaffold13041supercontigscaffold13041:131143..131357 +
scaffold4853supercontigscaffold4853:187560..187776 -
scaffold4853supercontigscaffold4853:176106..176320 -
Gbar_D07chromosomeGbar_D07:5148494..5148730 +
Gbar_A07chromosomeGbar_A07:5464217..5464433 +
D07chromosomeD07:5076555..5076794 +
A07chromosomeA07:5345652..5345868 +
CM017629.1chromosomeCM017629.1:5379596..5379847 +
CM017616.1chromosomeCM017616.1:5267123..5267342 +
CM017655.1chromosomeCM017655.1:5245449..5245676 +
CM017642.1chromosomeCM017642.1:5499083..5499317 +
CM017707.1chromosomeCM017707.1:5133577..5133810 +
CM017694.1chromosomeCM017694.1:5439177..5439408 +
Chr01chromosomeNAU1043:1..657 .
Chr01:4788082..4788720 +
scaffold141supercontigNAU1043:1..657 .
scaffold141:356539..357177 -
Sequence
>NAU1043 ID=NAU1043|Name=NAU1043|organism=Gossypium arboreum|type=genetic_marker|length=238bp
GTATCCGCCCACAAATAAAGCAAGCAGCTTTATTAATATCTCTTTAATTC
AATTTTCCTTATCTCTCTTTGAGTCTTCAATTGATTGCCCAGATTTTTCT
TCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTTCTCTTCAAT
TCACGATCTGCATTAGCTATTTTATCATGCTTTTCTTAAAACTTTTCCTT
CTCTTTTCTTTGTTTTCCTTCACTTTCTCTCACGATGC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A07N/AAD_chr.060NAU1043
2CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr07N/AAD_chr.07137.7NAU1043
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c07N/AAD_chr.0791NAU1043
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch07N/AAD_chr.0756.78NAU1043
5AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr07N/AAD_chr.07149NAU1043
6Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_lg05N/AAD_unknown0NAU1043
77235 x TM-1, F2:3 (2005)7T-F2:3_chr07N/AAD_chr.071.8NAU1043
8TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr16N/AAD_chr.16100.7NAU1043
9W10 x TM-1, F2:3 (2015)WT-F2:3_chr07-2N/AAD_chr.071.1NAU1043
10GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr07N/AAD_chr.0743.4NAU1043
11CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr07N/AAt.076.7NAU1043
12PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr07-1N/AAD_chr.070NAU1043a
13PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr07-1N/AAD_chr.0741.1NAU1043d
14PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr07-1N/AAD_chr.0766.5NAU1043c
15PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr07-1N/AAD_chr.0786.4NAU1043e
16PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr16N/AAD_chr.1672.3NAU1043b
17Prema x 86-1, RIL (2015)P8-RIL_chr07.7N/AAD_chr.0711.87NAU1043-650