NAU1014, NAU1014 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1014
Genbank IDBQ405578
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(TCA)11
PCR ConditionAnnealing temperature: 57
Primer 1NAU1014_F: GCCTCCACTTGTTTTCTACC
Primer 2NAU1014_R: GGCACCCATATCAGAAGAAG
Product Length180
Restriction EnzymeEcoRI; XhoI
PolymorphismP_ NAU1014
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ405578
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1014_FNAU1014_FGossypium arboreumprimer
NAU1014_RNAU1014_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.7T-ch11.e1Gossypium hirsutumQTL
fiber elongationqFEL.7T-ch11.e2Gossypium hirsutumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqUHML.Y7-RIL_ch11.bb12Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1014NAU1014Gossypium arboreummarker_locus
NAU1014-185NAU1014-185Gossypium arboreummarker_locus
NAU1014_276bNAU1014_276bGossypium arboreummarker_locus
NAU1014-150NAU1014-150Gossypium arboreummarker_locus
NAU1014NAU1014-109.331Gossypium arboreummarker_locus
NAU1014NAU1014-113.3Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A11chromosomeA11:69283485..69283648 +
D11chromosomeD11:47367894..47368061 -
CM018225.1chromosomeCM018225.1:45563828..45563995 -
CM018212.1chromosomeCM018212.1:77242277..77242462 -
D5_11chromosomeD5_11:22803032..22803199 +
KI_11chromosomeKI_11:33933728..33933895 -
Chr4chromosomeChr4:89300250..89300429 +
tig00014224_CRI-A2_v1.0.a1chromosometig00014224_CRI-A2_v1.0.a1:193294..193473 -
scaffold159supercontigscaffold159:324765..324932 +
D10_11chromosomeD10_11:44141838..44142008 -
CM016624.1chromosomeCM016624.1:95213155..95213322 +
At_chr4chromosomeAt_chr4:50040216..50040379 +
scaffold2918_A11supercontigscaffold2918_A11:482754..482917 -
D11chromosomeD11:43005589..43005756 -
Ghir_A11chromosomeGhir_A11:85565866..85566029 +
Ghir_D11chromosomeGhir_D11:47785969..47786136 -
A11chromosomeA11:84243181..84243344 +
D11chromosomeD11:47467571..47467738 -
A11chromosomeA11:81928787..81928950 +
D11chromosomeD11:47782717..47782884 -
A11chromosomeA11:79828456..79828619 +
D11chromosomeD11:45079156..45079323 -
Dt11chromosomeDt11:46474910..46475077 -
scaffold9696supercontigscaffold9696:74524..74709 -
scaffold9696supercontigscaffold9696:72361..72531 -
scaffold5855supercontigscaffold5855:344500..344667 -
Gbar_D11chromosomeGbar_D11:45267582..45267749 -
Gbar_A11chromosomeGbar_A11:75314570..75314755 -
A11chromosomeA11:79602558..79602743 +
D11chromosomeD11:47788890..47789057 -
CM017633.1chromosomeCM017633.1:47411078..47411245 -
CM017620.1chromosomeCM017620.1:80733670..80733846 -
CM017659.1chromosomeCM017659.1:48433779..48433949 -
CM017646.1chromosomeCM017646.1:87579479..87579661 -
CM017711.1chromosomeCM017711.1:45598882..45599049 -
CM017698.1chromosomeCM017698.1:77362337..77362519 -
Sequence
>NAU1014 ID=NAU1014|Name=NAU1014|organism=Gossypium arboreum|type=genetic_marker|length=180bp
GCCTCCACTTGTTTTCTACCCCCCATCTCCTTTAATCCTATCTCATCATC
ATCATCATCATCATCATCATCATCATTTATGGGTCTTGCTCTGGTAAAAA
CCCATCATCAAGGTAGCTTTATTATGGGTCAGTTTAGACGGTTGGTTATC
AACTGTTCAGCTTCTTCTGATATGGGTGCC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A11N/AAD_chr.110NAU1014
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr11N/AAD_chr.1198NAU1014
3TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.11bN/AAD_chr.1167.3NAU1014
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c11N/AAD_chr.11105.6NAU1014
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr11-3N/AAD_chr.1122.4NAU1014
67235 x TM-1, F2:3 (2005)7T-F2:3_chr11/LGA03N/AAD_chr.110NAU1014
7Yumian-1 x T586, RIL (2015)YT-RIL.15_chr11N/AAD_chr.1172.7NAU1014
8Yumian-1 x 7235, RIL (2015)Y7-RIL_chr11N/AAD_chr.1163.7NAU1014
9TM-1 x 3-79, RIL (2014)T3-RIL.14_chr11N/AAD_chr.11109.3NAU1014
10GX1135 x GX100-2, F2 (2013)GG-F2_chr11-2N/AAD_chr.115.1NAU1014
11GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr11N/AAD_chr.11196.6NAU1014
12CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr11N/AAt.11151.4NAU1014
13TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr11N/AAD_chr.1173NAU1014-185
14TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr11/A11N/AAD_chr.1174.11NAU1014-185
15TM-1 x 3-79, RIL (2011)T3-RIL.11_chr11N/AAD_chr.1131.9NAU1014_276b
16Prema x 86-1, RIL (2015)P8-RIL_chr11.3N/AAD_chr.1116.09NAU1014-150
17TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.11N/AAD_chr.11109.33NAU1014
18PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr11N/AAt.11113.3NAU1014