NAU0998, NAU0998 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU0998
AliasNAU998
Genbank IDBQ406381
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(TCATG)4
PCR ConditionAnnealing temperature: 57
Primer 1NAU998_F: CTCTCTCTCACACACGCACT
Primer 2NAU998_R: CTGGCCAAGTGACACAATTA
Product Length166
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ406381
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU998_FNAU998_FGossypium arboreumprimer
NAU998_RNAU998_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed stearic acid contentqFASTE.YT-RIL_ch14.cq11.2Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU998NAU998Gossypium arboreummarker_locus
nau0998nau0998Gossypium arboreummarker_locus
NAU0998bNAU0998bGossypium arboreummarker_locus
NAU0998aNAU0998aGossypium arboreummarker_locus
NAU998-160NAU998-160Gossypium arboreummarker_locus
NAU0998/200y(C14)NAU0998/200y(C14)Gossypium arboreummarker_locus
NAU0998bNAU0998b-78.655Gossypium arboreummarker_locus
NAU0998aNAU0998a-79.871Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D02chromosomeD02:64763240..64763397 -
A03chromosomeA03:101151218..101151383 -
CM018216.1chromosomeCM018216.1:61084895..61085057 -
CM018204.1chromosomeCM018204.1:99140776..99140955 -
D5_03chromosomeD5_03:5808574..5808757 +
KI_03chromosomeKI_03:37780837..37781010 -
Chr5chromosomeChr5:17594551..17594716 +
Chr03_CRI-A2_v1.0.a1chromosomeChr03_CRI-A2_v1.0.a1:128304676..128304840 -
Chr5chromosomeChr5:39221113..39221292 +
D10_03chromosomeD10_03:5746197..5746388 +
CM016616.1chromosomeCM016616.1:8472191..8472360 +
Dt_chr5chromosomeDt_chr5:14259486..14259641 +
At_chr5chromosomeAt_chr5:47920218..47920383 +
D02chromosomeD02:61958671..61958828 -
A03chromosomeA03:93482494..93482659 -
Ghir_D02chromosomeGhir_D02:63763210..63763370 -
Ghir_A03chromosomeGhir_A03:105816628..105816791 -
D02chromosomeD02:63956414..63956571 -
A03chromosomeA03:104742751..104742916 -
D02chromosomeD02:65115712..65115867 -
A03chromosomeA03:102893533..102893696 -
D02chromosomeD02:62231603..62231760 -
A03chromosomeA03:98157506..98157671 -
scaffold47345supercontigscaffold47345:46964..47143 +
scaffold4281supercontigscaffold4281:169822..169984 +
scaffold4281supercontigscaffold4281:167521..167683 +
scaffold4281supercontigscaffold4281:163991..164153 +
Gbar_D02chromosomeGbar_D02:61646669..61646831 -
Gbar_A03chromosomeGbar_A03:98301888..98302065 -
D02chromosomeD02:63011587..63011749 -
A03chromosomeA03:100667110..100667289 -
CM017624.1chromosomeCM017624.1:64001634..64001791 -
CM017612.1chromosomeCM017612.1:99922283..99922449 -
CM017650.1chromosomeCM017650.1:65635651..65635808 -
CM017638.1chromosomeCM017638.1:107069567..107069732 -
CM017702.1chromosomeCM017702.1:62560347..62560509 -
CM017690.1chromosomeCM017690.1:101065848..101066023 -
Sequence
>NAU0998 ID=NAU0998|Name=NAU0998|organism=Gossypium arboreum|type=genetic_marker|length=166bp
CTCTCTCTCACACACGCACTCACTCCGTCTCTCATGTCATGTCATGTCAT
GCAAGTAGCACCTAAGCTTTTAAGTTTTTAACCCCTCTCTGCGCTCTCTC
TCTCTCTCTCTCTCACACACACTCCCTTCACCCCACGACATTTGTTTAAT
TGTGTCACTTGGCCAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A03N/AAD_chr.0336.6NAU998
2Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch03/A03N/AAD_chr.030NAU998
37235 x TM-1, F2:3 (2005)7T-F2:3_chr03N/AAD_chr.0380.1NAU998
4HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr03-1N/AAD_chr.0324.5NAU998
5PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr03-1N/AAD_chr.0317.3NAU998
6TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr03N/AAD_chr.0396.8NAU998
7(86-1 x G. anomalum) x Su8289, BC2F1 (2015)8S-BC2F1_chr02N/AB_chr.02108.5NAU998
8CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr03N/AAt.0376.9NAU998
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr14N/ADt.02101.3NAU998
10AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr14N/AAD_chr.14186nau0998
11AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr03N/AAD_chr.03173nau0998
12TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.03N/AAD_chr.0397.5nau0998
13Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr14N/AAD_chr.1436.5nau0998
14Yumian-1 x T586, RIL (2006)YT-RIL_chr14-3N/AAD_chr.1455.6nau0998
15Yumian-1 x T586, RIL (2015)YT-RIL.15_chr14N/AAD_chr.14110.4nau0998
16TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c03N/AAD_chr.0337.71NAU0998b
17TM-1 x 3-79, RIL (2014)T3-RIL.14_chr03N/AAD_chr.0378.7NAU0998b
18TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c14N/AAD_chr.1446.55NAU0998a
19TM-1 x 3-79, RIL (2014)T3-RIL.14_chr14N/AAD_chr.1479.9NAU0998a
20TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr14N/AAD_chr.1446.6NAU998-160
21TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr14/D2N/AAD_chr.1448.11NAU998-160
22Yumian-1 x T586, RIL (2009)YT-RIL_chr14-1N/AAD_chr.1426.7NAU0998/200y(C14)
23TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.03N/AAD_chr.0378.66NAU0998b
24TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.14N/AAD_chr.1479.87NAU0998a