NAU0895, NAU0895 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU0895
AliasNAU895
Genbank IDBQ411825
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(ACAT)10
PCR ConditionAnnealing temperature: 57
Primer 1NAU895_F: CATGATGCACACTTCACACA
Primer 2NAU895_R: CGGTTAAGCTTCCAGACATT
Product Length202
Restriction EnzymeEcoRI; XhoI
PolymorphismP_ NAU0895
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ411825
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU895_FNAU895_FGossypium arboreumprimer
NAU895_RNAU895_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU895aNAU895aGossypium arboreummarker_locus
NAU0895NAU0895Gossypium arboreummarker_locus
NAU0895aNAU0895aGossypium arboreummarker_locus
NAU0895bNAU0895bGossypium arboreummarker_locus
NAU895-260NAU895-260Gossypium arboreummarker_locus
NAU895NAU895Gossypium arboreummarker_locus
NAU0895NAU0895-119.4Gossypium arboreummarker_locus
NAU0895aNAU0895a-3.658Gossypium arboreummarker_locus
NAU0895bNAU0895b-126.421Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D03chromosomeD03:354388..354577 +
A02chromosomeA02:90051651..90051856 -
CM018217.1chromosomeCM018217.1:319537..319730 +
CM018203.1chromosomeCM018203.1:99541292..99541477 -
Chr1chromosomeChr1:134891666..134891867 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:442870..443071 +
CM016615.1chromosomeCM016615.1:343508..343696 +
scaffold1977.1supercontigscaffold1977.1:310708..310897 +
At_chr4chromosomeAt_chr4:23362330..23362535 -
D03chromosomeD03:311928..312121 +
A02chromosomeA02:83057705..83057910 -
Ghir_D03chromosomeGhir_D03:315873..316062 +
Ghir_A02chromosomeGhir_A02:107705898..107706103 -
D03chromosomeD03:317524..317713 +
A02chromosomeA02:107903525..107903730 -
D03chromosomeD03:313063..313252 +
A02chromosomeA02:105363308..105363513 -
D03chromosomeD03:317898..318087 +
A02chromosomeA02:103944428..103944633 -
At02chromosomeAt02:89471097..89471282 -
scaffold28823supercontigscaffold28823:59171..59364 -
scaffold23613supercontigscaffold23613:146546..146731 -
Gbar_D03chromosomeGbar_D03:312350..312543 +
Gbar_A02chromosomeGbar_A02:99834962..99835147 -
D03chromosomeD03:319672..319861 +
A02chromosomeA02:101772449..101772634 -
CM017625.1chromosomeCM017625.1:317751..317940 +
CM017611.1chromosomeCM017611.1:104749307..104749488 -
CM017651.1chromosomeCM017651.1:371976..372161 +
CM017637.1chromosomeCM017637.1:109541231..109541436 -
CM017703.1chromosomeCM017703.1:341670..341851 +
CM017689.1chromosomeCM017689.1:101923852..101924025 -
Sequence
>NAU0895 ID=NAU0895|Name=NAU0895|organism=Gossypium arboreum|type=genetic_marker|length=202bp
CATGATGCACACTTCACACACATGTACACACTTGCACAGACATACATACA
TACATACATACATACATACATACATACATACTTTCTTACAACGACGCCCA
TTTTTTGCAAACTAATGCCTCAACAAAGAACTAAGAACAGAAGAAATCTG
CAATTGATACACATGGTGATTTACGTCGTAAGAATGTCTGGAAGCTTAAC
CG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr02N/AAD_chr.02171.4NAU895a
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c02N/AAD_chr.0298.9NAU0895
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.0211NAU0895
4(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr02-1N/AAD_chr.0211.7NAU0895
5Yumian-1 x T586, RIL (2015)YT-RIL.15_chr02N/AAD_chr.02141.2NAU0895
6Yumian-1 x 7235, RIL (2015)Y7-RIL_chr02N/AAD_chr.0297.9NAU0895
7CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.020NAU0895
8TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c02N/AAD_chr.023.67NAU0895a
9TM-1 x 3-79, RIL (2014)T3-RIL.14_chr02N/AAD_chr.023.7NAU0895a
10TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c14N/AAD_chr.140NAU0895b
11TM-1 x 3-79, RIL (2014)T3-RIL.14_chr14N/AAD_chr.14126.4NAU0895b
12TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr02N/AAD_chr.023NAU895-260
13TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr02/A2N/AAD_chr.02111.63NAU895-260
14HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr02N/AAD_chr.020NAU895
15Prema x 86-1, RIL (2015)P8-RIL_chr02.2N/AAD_chr.024.04NAU895
16TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr24-1N/AAD_chr.241.4NAU895
17GX1135 x GX100-2, F2 (2013)GG-F2_chr02-4N/AAD_chr.023.3NAU895
18GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr04-1N/AAD_chr.04129.2NAU895
19(86-1 x G. anomalum) x Su8289, BC2F1 (2015)8S-BC2F1_chr03N/AB_chr.03110.7NAU895
20CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.02119.4NAU0895
21TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.02N/AAD_chr.023.66NAU0895a
22TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.14N/AAD_chr.14126.42NAU0895b