NAU0879, NAU0879 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU0879
AliasNAU879
Genbank IDBQ413089
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(AT)11
PCR ConditionAnnealing temperature: 57
Primer 1NAU879_F: AGGAACCGATTCAAAGCTAA
Primer 2NAU879_R: TTTCCCCATTCTTGGTTAAG
Product Length203
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ413089
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU879_FNAU879_FGossypium arboreumprimer
NAU879_RNAU879_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU879NAU879Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D05chromosomeD05:3224896..3225084 -
A05chromosomeA05:3583072..3583268 -
CM018219.1chromosomeCM018219.1:3011315..3011507 -
CM018206.1chromosomeCM018206.1:3542697..3542889 -
D5_05chromosomeD5_05:2832585..2832775 -
KI_05chromosomeKI_05:2594826..2595011 -
Chr9chromosomeChr9:57284238..57284440 +
Chr05_CRI-A2_v1.0.a1chromosomeChr05_CRI-A2_v1.0.a1:3467838..3468040 -
Chr9chromosomeChr9:3809754..3809944 +
D10_05chromosomeD10_05:57666094..57666280 +
CM016626.1chromosomeCM016626.1:4955262..4955452 -
Dt_chr9chromosomeDt_chr9:66326754..66326942 +
At_chr9chromosomeAt_chr9:50754622..50754838 +
scaffold1240_A05supercontigscaffold1240_A05:59447..59643 -
D05chromosomeD05:3064047..3064235 -
Ghir_D05chromosomeGhir_D05:3199581..3199769 -
Ghir_A05chromosomeGhir_A05:3583324..3583524 -
D05chromosomeD05:2999757..2999945 -
A05chromosomeA05:3458654..3458850 -
D05chromosomeD05:3109783..3109971 -
A05chromosomeA05:3557440..3557636 -
D05chromosomeD05:2970085..2970273 -
A05chromosomeA05:3961978..3962174 -
scaffold10000supercontigscaffold10000:477857..478049 +
scaffold3667supercontigscaffold3667:33154..33346 -
Gbar_D05chromosomeGbar_D05:3100476..3100668 -
Gbar_A05chromosomeGbar_A05:3232160..3232352 -
D05chromosomeD05:3251524..3251716 -
A05chromosomeA05:3713334..3713526 -
CM017627.1chromosomeCM017627.1:3081429..3081615 -
CM017614.1chromosomeCM017614.1:3544992..3545182 -
CM017653.1chromosomeCM017653.1:3247115..3247303 -
CM017640.1chromosomeCM017640.1:3609823..3610013 -
CM017705.1chromosomeCM017705.1:3072642..3072836 -
CM017692.1chromosomeCM017692.1:3510276..3510466 -
Sequence
>NAU0879 ID=NAU0879|Name=NAU0879|organism=Gossypium arboreum|type=genetic_marker|length=203bp
AGGAACCGATTCAAAGCTAATCTTTGGGGTGGCTTGACAAGTCTATCCTA
AAATAGCTTGTTCTCAGCTATATATATATATATATATATATTTACCTAAT
ACAAAAAAACAAAGAGAATGGTCCCAATGTCATCGAAAACATGGCACAAA
TAACTCCAAAAAATTGTTCATCCCGGCTAGAGGCTTAACCAAGAATGGGG
AAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A10N/AAD_chr.100NAU879
2Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch05/A05-1N/AAD_chr.054.8NAU879
37235 x TM-1, F2:3 (2005)7T-F2:3_chr10N/AAD_chr.1026.9NAU879
4HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr10N/AAD_chr.100NAU879
5CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr05N/AAt.050NAU879