NAU0748, NAU0748 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU0748
AliasNAU748
Genbank IDBQ415464
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(CATGGA)3
PCR ConditionAnnealing temperature: 57
Primer 1NAU748_F: TTTTGGACCTGAAACATTGA
Primer 2NAU748_R: TGTTGATAATCGTCGTCGTC
Product Length225
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ415464
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU748_FNAU748_FGossypium arboreumprimer
NAU748_RNAU748_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber strengthqFS.GG-RIL.16_ch18-1.hd12Gossypium hirsutumQTL
fiber strengthqFS.GG-RIL.16_ch18-1.xy12Gossypium hirsutumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
embryogenic callus formationqECF.WT-F2:3_chr18Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU0748NAU0748Gossypium arboreummarker_locus
NAU748NAU748Gossypium arboreummarker_locus
NAU0748NAU0748-41.722Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A10chromosomeA10:45662912..45663135 +
D13chromosomeD13:11987290..11987513 -
CM018227.1chromosomeCM018227.1:11235487..11235709 -
CM018214.1chromosomeCM018214.1:9858240..9858463 -
D5_13chromosomeD5_13:11144568..11144791 -
Chr13chromosomeChr13:52918016..52918240 -
Chr13_CRI-A2_v1.0.a1chromosomeChr13_CRI-A2_v1.0.a1:13828111..13828335 +
Chr13chromosomeChr13:22854355..22854578 -
D10_13chromosomeD10_13:11228072..11228288 -
CM016626.1chromosomeCM016626.1:47652315..47652535 +
scaffold684.1supercontigscaffold684.1:244499..244722 -
Dt_chr13chromosomeDt_chr13:47619889..47620112 -
scaffold3432_A13supercontigscaffold3432_A13:802008..802231 -
D13chromosomeD13:11570467..11570690 -
Ghir_D13chromosomeGhir_D13:11547412..11547634 -
Ghir_A13chromosomeGhir_A13:9810023..9810246 -
D13chromosomeD13:11294494..11294717 -
A13chromosomeA13:10061694..10061917 -
D13chromosomeD13:11769750..11769973 -
A13chromosomeA13:9780647..9780870 -
D13chromosomeD13:11445670..11445899 -
A13chromosomeA13:9967677..9967900 -
Dt13chromosomeDt13:11778462..11778684 -
scaffold7851supercontigscaffold7851:153948..154170 +
scaffold14230supercontigscaffold14230:132558..132780 -
Gbar_D13chromosomeGbar_D13:11435910..11436132 -
Gbar_A13chromosomeGbar_A13:9784836..9785059 -
D13chromosomeD13:10833014..10833236 -
A13chromosomeA13:9938054..9938277 -
CM017635.1chromosomeCM017635.1:11301924..11302147 -
CM017622.1chromosomeCM017622.1:9884993..9885213 -
CM017661.1chromosomeCM017661.1:11844719..11844942 -
CM017648.1chromosomeCM017648.1:10497351..10497574 -
CM017713.1chromosomeCM017713.1:11439278..11439500 -
CM017700.1chromosomeCM017700.1:9848030..9848253 -
Sequence
>NAU0748 ID=NAU0748|Name=NAU0748|organism=Gossypium arboreum|type=genetic_marker|length=225bp
TTTTGGACCTGAAACATTGACCCTAAACAATGTTACTTCTTCTCCAAATT
CTCCTATAAATTGTCCAACCACGCCACTTGCTCTTCAAGCCTTAATTTCC
ACCTTACTCAAAACTTCTCTTTTTCCCATGGACATGGACATGGACTATGA
AAACGATGGCTTCTATGCTGAAATTAAAAGACAGATTCTACTTTTAACAG
CTGAAGACGACGACGATTATCAACA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr18N/AAD_chr.1835.3NAU0748View
2GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr01N/AAD_chr.01290.3NAU0748View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr18N/AAD_chr.1882.5NAU0748View
4PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr18N/AAD_chr.180NAU748View
5W10 x TM-1, F2:3 (2015)WT-F2:3_chr18N/AAD_chr.180NAU748View
6GX1135 x GX100-2, F2 (2013)GG-F2_chr18-1N/AAD_chr.1828.6NAU748View
7GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr18-1N/AAD_chr.18107.6NAU748View
8GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr18-1N/AAD_chr.18107.6NAU748View
9CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr18N/ADt.1341.72NAU0748View