MUSS0422, MUSS0422 (genetic_marker) Gossypium arboreum

Marker Overview
NameMUSS0422
AliasMUSS422
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifGT(6)
PCR ConditionAnnealing temperature: 55
Primer 1MUSS422_F: tggttttgcccatctttacg
Primer 2MUSS422_R: GAAAGGGAAGATGAGGAGGG
Product Length188
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Germplasm
Stock NameType
AKA 8401cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUSS422_FMUSS422_FGossypium arboreumprimer
MUSS422_RMUSS422_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
verticillium wilt disease incidenceqVWDI.0s-RIL.17_ch01.ay15.3Gossypium hirsutumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber uniformityqFU.MAGIC-19831_ch01.hg13Gossypium spp.QTL
short fiber contentqSFC.MAGIC-19831_ch01.hg13Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUSS422aMUSS422aGossypium arboreummarker_locus
MUSS422bMUSS422bGossypium arboreummarker_locus
MUSS422MUSS422Gossypium arboreummarker_locus
muss0422muss0422Gossypium arboreummarker_locus
MUSS422bMUSS422b-82.107Gossypium arboreummarker_locus
MUSS422aMUSS422a-55.48Gossypium arboreummarker_locus
MUSS422aMUSS422a-95.1Gossypium arboreummarker_locus
MUSS422bMUSS422b-115.6Gossypium arboreummarker_locus


Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr10chromosomeChr10:9752095..9752282 +
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:39361993..39362180 -
D10_01chromosomeD10_01:38706374..38706567 -
Dt_chr2chromosomeDt_chr2:35885697..35885897 -
CM017636.1chromosomeCM017636.1:33352088..33352274 +
Sequence
>MUSS0422 ID=MUSS0422|Name=MUSS0422|organism=Gossypium arboreum|type=genetic_marker|length=188bp
TGGTTTTGCCCATCTTTACGTATTTCCGGGACCGAATCAAACCCAGCAGG
CAGCAGGCAGCAGGCAGCAGGCAAAGAGAGAGAGTGTGTGTGTGTTTCTC
ACCTTACCTTAAAATATATTAACAATTTTTTTAAAATGACGGTTTCAATA
TTTTATAACATTCCATCACCCTCCTCATCTTCCCTTTC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0136.41MUSS422a
2TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c15N/AAD_chr.1564.26MUSS422a
3TM-1 x 3-79, RIL (2014)T3-RIL.14_chr15N/AAD_chr.1555.5MUSS422a
4Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr15N/AAD_chr.15104.32MUSS422b
5TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c01N/AAD_chr.0162.27MUSS422b
6TM-1 x 3-79, RIL (2014)T3-RIL.14_chr01N/AAD_chr.0182.1MUSS422b
7Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c15N/AAD_chr.1568.85MUSS422
8Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch01N/AAD_chr.0156.96MUSS422
9Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch15N/AAD_chr.1539.45MUSS422
10TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.01N/AAD_chr.0139.9MUSS422
11Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c01N/AAD_chr.0170.97MUSS422
12GX1135 x GX100-2, F2 (2013)GG-F2_chr01N/AAD_chr.0162.6MUSS422
13GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.01120.4MUSS422
140-153 x sGK9708, RIL (2016)0s-RIL_chr15-2N/AAD_chr.1516.5MUSS422
15CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr15N/ADt.0184MUSS422
160-153 x sGK9708, RIL (2017)0s-RIL.17_chr01N/AAD_chr.0169.28MUSS422
17AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr01N/AAD_chr.0166muss0422
18AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr15N/AAD_chr.1589muss0422
19TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.01N/AAD_chr.0182.11MUSS422b
20TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.15N/AAD_chr.1555.48MUSS422a
21MGG-293-793, MAGIC (2018)MAGIC-19831_chr01N/AAD_chr.0195.1MUSS422a
22MGG-293-793, MAGIC (2018)MAGIC-19831_chr15N/AAD_chr.15115.6MUSS422b