MUSS0211, MUSS0211 (genetic_marker) Gossypium arboreum

Marker Overview
NameMUSS0211
AliasMUSS211
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifCTG(7)
PCR ConditionAnnealing temperature: 55
Primer 1MUSS211_F: TCAGCTGAGGGAATCTACGG
Primer 2MUSS211_R: TCATCCTATTCCCGATCACC
Product Length152
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Germplasm
Stock NameType
AKA 8401cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUSS211_FMUSS211_FGossypium arboreumprimer
MUSS211_RMUSS211_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUSS211MUSS211Gossypium arboreummarker_locus


Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:2605840..2606328 -
A01chromosomeA01:3931234..3931712 -
CM018215.1chromosomeCM018215.1:3006002..3006501 +
CM018202.1chromosomeCM018202.1:2976168..2976646 -
D5_01chromosomeD5_01:2852307..2852806 -
Chr13chromosomeChr13:66866960..66867437 -
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:3064146..3064623 -
Chr2chromosomeChr2:35087799..35088298 +
D10_01chromosomeD10_01:57863138..57863637 +
CM016614.1chromosomeCM016614.1:4117118..4117615 -
scaffold732.1supercontigscaffold732.1:151410..151888 -
scaffold3420.1supercontigscaffold3420.1:95762..96250 -
D01chromosomeD01:2608232..2608720 -
A01chromosomeA01:2685362..2685840 -
Ghir_D01chromosomeGhir_D01:3057688..3058176 -
Ghir_A01chromosomeGhir_A01:3243294..3243772 -
D01chromosomeD01:2884959..2885447 -
A01chromosomeA01:3109309..3109787 -
D01chromosomeD01:3052436..3052924 -
A01chromosomeA01:3246081..3246559 -
D01chromosomeD01:2927371..2927859 -
A01chromosomeA01:3198242..3198720 -
At01chromosomeAt01:2777672..2778150 -
At01chromosomeAt01:2772752..2773230 -
scaffold18654supercontigscaffold18654:93729..94207 -
scaffold18654supercontigscaffold18654:88809..89287 -
scaffold1094supercontigscaffold1094:828743..829242 -
Gbar_D01chromosomeGbar_D01:3236091..3236590 -
Gbar_A01chromosomeGbar_A01:2965570..2966048 -
D01chromosomeD01:3266696..3267195 -
A01chromosomeA01:2965057..2965535 -
CM017623.1chromosomeCM017623.1:3111849..3112337 -
CM017610.1chromosomeCM017610.1:3501788..3502266 -
CM017649.1chromosomeCM017649.1:2988333..2988833 -
CM017636.1chromosomeCM017636.1:2987209..2987687 -
CM017701.1chromosomeCM017701.1:3247286..3247785 -
CM017688.1chromosomeCM017688.1:2994676..2995154 -
Sequence
>MUSS0211 ID=MUSS0211|Name=MUSS0211|organism=Gossypium arboreum|type=genetic_marker|length=152bp
TCAGCTGAGGGAATCTACGGCTTCCGAGGAGGCGAACTACTGCTGCTGCT
GTTGCTGCTGCTTCTTCTTCCTCTCAATGGCCTCCTAGGACTGCGACTCC
TTGAAACCCTTCGTCCTGCCTTTCGGGGACTGGGTGATCGGGAATAGGAT
GA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A01N/AA_chr.0137.8MUSS211View