MUSS0107, MUSS0107 (genetic_marker) Gossypium arboreum

Marker Overview
NameMUSS0107
AliasMUSS107
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifGAC(6)
PCR ConditionAnnealing temperature: 55
Primer 1MUSS107_F: GCTAGATCGATTGCTAACTCGC
Primer 2MUSS107_R: ATGATGAATGGGAATGAGAAGG
Product Length177
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Germplasm
Stock NameType
AKA 8401cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUSS107_FMUSS107_FGossypium arboreumprimer
MUSS107_RMUSS107_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
verticillium wilt disease incidenceqVWDI.0s-RIL.17_ch02.aygh.1Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUSS107MUSS107Gossypium arboreummarker_locus
MUSS107/130yMUSS107/130yGossypium arboreummarker_locus
MUSS107MUSS107-83.602Gossypium arboreummarker_locus


Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D03chromosomeD03:3180351..3180480 +
A02chromosomeA02:86984844..86984976 -
CM018217.1chromosomeCM018217.1:2918832..2918961 +
CM018203.1chromosomeCM018203.1:96612496..96612628 -
D5_02chromosomeD5_02:2904166..2904295 +
KI_06chromosomeKI_06:42739781..42739916 +
Chr3chromosomeChr3:36610091..36610223 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:2893889..2894021 +
Chr7chromosomeChr7:49037913..49038042 +
D10_02chromosomeD10_02:2864636..2864765 +
CM016615.1chromosomeCM016615.1:4166293..4166428 +
scaffold712.1supercontigscaffold712.1:665609..665738 +
scaffold3246.1supercontigscaffold3246.1:8493..8625 +
D03chromosomeD03:2943956..2944085 +
scaffold21468supercontigscaffold21468:90..222 -
A02chromosomeA02:80354194..80354326 -
Ghir_D03chromosomeGhir_D03:3033947..3034076 +
Ghir_A02chromosomeGhir_A02:104788354..104788486 -
D03chromosomeD03:2976495..2976624 +
A02chromosomeA02:105046794..105046926 -
D03chromosomeD03:3042172..3042301 +
A02chromosomeA02:102424250..102424382 -
D03chromosomeD03:3038239..3038368 +
A02chromosomeA02:101042252..101042384 -
At02chromosomeAt02:85724782..85724914 -
scaffold4125supercontigscaffold4125:916..1045 -
scaffold2476supercontigscaffold2476:98494..98626 -
Gbar_D03chromosomeGbar_D03:2926940..2927069 +
Gbar_A02chromosomeGbar_A02:96779844..96779976 -
D03chromosomeD03:2965819..2965948 +
A02chromosomeA02:98803373..98803505 -
CM017625.1chromosomeCM017625.1:2955649..2955778 +
CM017611.1chromosomeCM017611.1:101663259..101663391 -
CM017651.1chromosomeCM017651.1:3060640..3060775 +
CM017637.1chromosomeCM017637.1:106489897..106490029 -
CM017703.1chromosomeCM017703.1:2943186..2943315 +
CM017689.1chromosomeCM017689.1:98978314..98978446 -
Chr03chromosomeMUSS0107:16..702 .
Chr03:2911471..2912903 +
Chr7chromosomeMUSS0107:16..702 .
Chr7:49037866..49039298 +
Sequence
>MUSS0107 ID=MUSS0107|Name=MUSS0107|organism=Gossypium arboreum|type=genetic_marker|length=133bp
GCTAGATCGATTGCTAACTCGCTCAAGCTTGACGACGACGACGACGACGA
TCGGACCAATGCGGCGCTGGATCCGAAACCCGAATCCGATCCGAATCCTA
ACCAAGCCTCTCCTTCTCATTCCCATTCATCAT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Yumian-1 x T586, RIL (2006)YT-RIL_chr02-2N/AAD_chr.0248MUSS107
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr02N/AAD_chr.02108.2MUSS107
30-153 x sGK9708, RIL (2016)0s-RIL_chr02-1N/AAD_chr.020MUSS107
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.0235.3MUSS107
50-153 x sGK9708, RIL (2017)0s-RIL.17_chr02N/AAD_chr.0216.05MUSS107
6Yumian-1 x T586, RIL (2009)YT-RIL_chr02-1N/AAD_chr.0245.2MUSS107/130y
7CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.0283.6MUSS107